| @@ -1,1708 +1,3829 @@ | ||
| 1 | 1 | msgid "" |
| 2 | 2 | msgstr "" |
| 3 | 3 | "Project-Id-Version: WP VR\n" |
| 4 | -"Report-Msgid-Bugs-To: \n" | |
| 5 | -"POT-Creation-Date: 2019-12-11 10:17+0000\n" | |
| 6 | -"PO-Revision-Date: 2024-03-05 03:29+0000\n" | |
| 7 | -"Last-Translator: devadmin <[email protected]>\n" | |
| 4 | +"Report-Msgid-Bugs-To: https://wordpress.org/support/plugin/wpvr\n" | |
| 5 | +"POT-Creation-Date: 2026-08-20T04:39:59+00:00\n" | |
| 6 | +"PO-Revision-Date: 2025-08-20 07:18+0000\n" | |
| 7 | +"Last-Translator: \n" | |
| 8 | 8 | "Language-Team: Polish\n" |
| 9 | 9 | "Language: pl_PL\n" |
| 10 | -"Plural-Forms: nplurals=3; plural=(n==1 ? 0 : n%10 >= 2 && n%10<=4 " | |
| 11 | -"&&(n%100<10||n%100 >= 20)? 1 : 2);\n" | |
| 12 | 10 | "MIME-Version: 1.0\n" |
| 13 | 11 | "Content-Type: text/plain; charset=UTF-8\n" |
| 14 | 12 | "Content-Transfer-Encoding: 8bit\n" |
| 13 | +"Plural-Forms: nplurals=3; plural=(n==1 ? 0 : n%10 >= 2 && n%10<=4 &&(n" | |
| 14 | +"%100<10||n%100 >= 20)? 1 : 2);\n" | |
| 15 | 15 | "X-Generator: Loco https://localise.biz/\n" |
| 16 | -"X-Loco-Version: 2.3.1; wp-5.2.5" | |
| 16 | +"X-Loco-Version: 2.8.0; wp-6.8.2; php-8.3.8\n" | |
| 17 | 17 | |
| 18 | -#: admin/classes/class-wpvr-meta-field.php:2256 | |
| 19 | -msgid " : " | |
| 18 | +#. Plugin Name of the plugin | |
| 19 | +#: wpvr.php | |
| 20 | +msgid "WP VR - 360 Panorama and Virtual Tour Builder" | |
| 20 | 21 | msgstr "" |
| 21 | 22 | |
| 22 | -#: oxygen/elements/Wpvr_Tour_Element.php:77 | |
| 23 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:119 | |
| 24 | -msgid "%" | |
| 23 | +#. Plugin URI of the plugin | |
| 24 | +#: wpvr.php | |
| 25 | +msgid "https://rextheme.com/wpvr/" | |
| 26 | +msgstr "https://rextheme.com/wpvr/" | |
| 27 | + | |
| 28 | +#. Description of the plugin | |
| 29 | +#: wpvr.php | |
| 30 | +#, fuzzy | |
| 31 | +msgid "" | |
| 32 | +"WP VR - 360 Panorama and virtual tour creator is a customized panaroma & " | |
| 33 | +"virtual builder tool for your website." | |
| 25 | 34 | msgstr "" |
| 35 | +"WP VR - 360 Panorama i Virtual Tour Creator dla WordPress to dostosowane " | |
| 36 | +"narzędzie Panaroma & Virtual Builder dla witryny WordPress." | |
| 26 | 37 | |
| 27 | -#: admin/partials/wpvr_setup_wizard.php:51 | |
| 28 | -msgid "360 Degree Panorama" | |
| 38 | +#. Author of the plugin | |
| 39 | +#: wpvr.php | |
| 40 | +msgid "Rextheme" | |
| 41 | +msgstr "rekstemet" | |
| 42 | + | |
| 43 | +#. Author URI of the plugin | |
| 44 | +#: wpvr.php | |
| 45 | +msgid "http://rextheme.com/" | |
| 46 | +msgstr "http://rextheme.com/" | |
| 47 | + | |
| 48 | +#: legacy/admin/class-wpvr-admin.php:245 | |
| 49 | +msgid "Write your css here" | |
| 50 | +msgstr "Napisz tutaj swój CSS tutaj" | |
| 51 | + | |
| 52 | +#: legacy/admin/class-wpvr-admin.php:246 | |
| 53 | +msgid "" | |
| 54 | +"Turning On The Video Option Will Erase Your Virtual Tour Data. Are You Sure?" | |
| 29 | 55 | msgstr "" |
| 56 | +"Włączenie opcji wideo usunie Twoje dane z wirtualnej wycieczki. Czy na pewno?" | |
| 30 | 57 | |
| 31 | -#: admin/partials/wpvr_setup_wizard.php:87 | |
| 32 | -msgid "360 Degree Video" | |
| 58 | +#: legacy/admin/class-wpvr-admin.php:247 | |
| 59 | +msgid "" | |
| 60 | +"Turning On The StreetView Option Will Erase Your Virtual Tour Data. Are You " | |
| 61 | +"Sure?" | |
| 33 | 62 | msgstr "" |
| 63 | +"Włączenie opcji StreetView spowoduje usunięcie danych z wirtualnej " | |
| 64 | +"wycieczki. Czy na pewno?" | |
| 34 | 65 | |
| 35 | -#: admin/partials/wpvr_documentation.php:472 | |
| 36 | -msgid "360 Video Support" | |
| 66 | +#: legacy/admin/class-wpvr-admin.php:248 | |
| 67 | +msgid "Adding Hotspots on Scene" | |
| 68 | +msgstr "Dodawanie hotspotów na scenie" | |
| 69 | + | |
| 70 | +#: legacy/admin/class-wpvr-admin.php:269 | |
| 71 | +msgid "Successfully Updated" | |
| 37 | 72 | msgstr "" |
| 38 | 73 | |
| 39 | -#: admin/partials/wpvr_documentation.php:444 | |
| 40 | -msgid "900+ Icons & RGB Color Support for Hotspots" | |
| 74 | +#: legacy/admin/class-wpvr-admin.php:270 | |
| 75 | +#, fuzzy | |
| 76 | +msgid "Importing..." | |
| 77 | +msgstr "znaczyć" | |
| 78 | + | |
| 79 | +#: legacy/admin/class-wpvr-admin.php:271 | |
| 80 | +#, fuzzy | |
| 81 | +msgid "Import Now" | |
| 82 | +msgstr "znaczyć" | |
| 83 | + | |
| 84 | +#: legacy/admin/class-wpvr-admin.php:275 | |
| 85 | +msgid "Published" | |
| 41 | 86 | msgstr "" |
| 42 | 87 | |
| 43 | -#: admin/classes/class-wpvr-meta-field.php:1648 | |
| 44 | -#: admin/classes/class-wpvr-meta-field.php:1674 | |
| 45 | -#: admin/classes/class-wpvr-meta-field.php:1699 | |
| 46 | -#: admin/classes/class-wpvr-meta-field.php:1721 | |
| 47 | -#: admin/classes/class-wpvr-meta-field.php:1844 | |
| 48 | -#: admin/classes/class-wpvr-meta-field.php:1876 | |
| 49 | -#: admin/classes/class-wpvr-meta-field.php:1909 | |
| 50 | -#: admin/classes/class-wpvr-meta-field.php:1937 | |
| 51 | -#: admin/classes/class-wpvr-meta-field.php:1970 | |
| 52 | -#: admin/classes/class-wpvr-meta-field.php:1995 | |
| 53 | -#: admin/classes/class-wpvr-meta-field.php:2020 | |
| 54 | -#: admin/classes/class-wpvr-meta-field.php:2081 | |
| 55 | -#: admin/classes/class-wpvr-meta-field.php:2107 | |
| 56 | -#: admin/classes/class-wpvr-meta-field.php:2148 | |
| 57 | -#: admin/classes/class-wpvr-meta-field.php:2177 | |
| 58 | -#: admin/classes/class-wpvr-meta-field.php:2209 | |
| 59 | -#: admin/classes/class-wpvr-meta-field.php:2291 | |
| 60 | -#: admin/classes/class-wpvr-meta-field.php:2313 | |
| 61 | -#: admin/classes/class-wpvr-meta-field.php:2337 | |
| 62 | -#: admin/classes/class-wpvr-meta-field.php:2370 | |
| 63 | -#: admin/classes/class-wpvr-meta-field.php:2390 | |
| 64 | -#: admin/classes/class-wpvr-meta-field.php:2420 | |
| 65 | -#: admin/classes/class-wpvr-meta-field.php:2445 | |
| 66 | -#: admin/classes/class-wpvr-meta-field.php:2472 | |
| 67 | -#: admin/classes/class-wpvr-meta-field.php:2496 | |
| 68 | -#: admin/classes/class-wpvr-meta-field.php:2523 | |
| 69 | -#: admin/classes/class-wpvr-meta-field.php:2556 | |
| 70 | -#: admin/classes/class-wpvr-meta-field.php:2586 | |
| 71 | -#: admin/classes/class-wpvr-meta-field.php:2610 | |
| 72 | -#: admin/classes/class-wpvr-meta-field.php:2634 | |
| 73 | -#: admin/classes/class-wpvr-meta-field.php:2658 | |
| 74 | -#: admin/classes/class-wpvr-meta-field.php:2681 | |
| 75 | -#: admin/classes/class-wpvr-meta-field.php:2706 | |
| 76 | -#: admin/classes/class-wpvr-meta-field.php:2732 | |
| 77 | -#: admin/classes/class-wpvr-meta-field.php:2756 | |
| 78 | -#: admin/classes/class-wpvr-meta-field.php:2795 | |
| 79 | -#: admin/classes/class-wpvr-meta-field.php:2820 | |
| 80 | -#: admin/classes/class-wpvr-meta-field.php:2848 | |
| 81 | -#: admin/classes/class-wpvr-meta-field.php:2890 | |
| 82 | -#: admin/classes/class-wpvr-meta-field.php:2922 | |
| 83 | -#: admin/classes/class-wpvr-meta-field.php:2973 | |
| 84 | -msgid ": " | |
| 88 | +#: legacy/admin/class-wpvr-admin.php:279 legacy/includes/setup-wizard.php:100 | |
| 89 | +#: src/Admin/Admin.php:211 app/components/modals/ImageResizeWarningModal.jsx:78 | |
| 90 | +msgid "Keep this panorama in High Resolution" | |
| 85 | 91 | msgstr "" |
| 86 | 92 | |
| 87 | -#: admin/partials/wpvr_license.php:28 admin/partials/wpvr_license.php:38 | |
| 88 | -msgid "Activate License" | |
| 89 | -msgstr "Aktywuj licencję" | |
| 93 | +#: legacy/admin/class-wpvr-admin.php:280 legacy/includes/setup-wizard.php:101 | |
| 94 | +#: src/Admin/Admin.php:212 app/components/modals/ImageResizeWarningModal.jsx:94 | |
| 95 | +msgid "" | |
| 96 | +"By default, a resized version is created while the original image is still " | |
| 97 | +"available." | |
| 98 | +msgstr "" | |
| 90 | 99 | |
| 91 | -#: admin/classes/class-tour-guide-translation.php:43 | |
| 92 | -msgid "" | |
| 93 | -"Add a Hotspot inside your tour to show additional information like Paragraph," | |
| 94 | -" Heading, Image, Video, or multiple content." | |
| 100 | +#: legacy/admin/class-wpvr-admin.php:281 legacy/includes/setup-wizard.php:102 | |
| 101 | +#: src/Admin/Admin.php:213 | |
| 102 | +#: app/components/modals/ImageResizeWarningModal.jsx:101 | |
| 103 | +#, fuzzy | |
| 104 | +msgid "Disable WordPress Large Image Handler on WP VR for future uploads" | |
| 105 | +msgstr "Wyłącz duży program obsługi obrazów WordPress na WP VR:" | |
| 106 | + | |
| 107 | +#: legacy/admin/class-wpvr-admin.php:282 legacy/includes/setup-wizard.php:103 | |
| 108 | +#: src/Admin/Admin.php:214 | |
| 109 | +#: app/components/modals/ImageResizeWarningModal.jsx:103 | |
| 110 | +msgid "*Note: Turn this on to use the high-resolution image." | |
| 95 | 111 | msgstr "" |
| 96 | 112 | |
| 97 | -#: admin/classes/class-wpvr-meta-field.php:757 | |
| 98 | -msgid "Add Company Information" | |
| 113 | +#: legacy/admin/class-wpvr-admin.php:283 legacy/includes/setup-wizard.php:104 | |
| 114 | +#: src/Admin/Admin.php:215 src/Admin/Admin.php:490 | |
| 115 | +#: app/components/modals/CreateSceneModal.jsx:476 | |
| 116 | +#: app/components/modals/ImageResizeWarningModal.jsx:86 | |
| 117 | +msgid "Close" | |
| 99 | 118 | msgstr "" |
| 100 | 119 | |
| 101 | -#: admin/classes/class-wpvr-meta-field.php:427 | |
| 102 | -msgid "Add Form Shortcode" | |
| 120 | +#: legacy/admin/class-wpvr-admin.php:318 | |
| 121 | +msgid "Please upload a scene before proceeding to set hotspot!" | |
| 103 | 122 | msgstr "" |
| 104 | 123 | |
| 105 | -#: admin/classes/class-wpvr-admin-pages.php:73 | |
| 124 | +#: legacy/admin/class-wpvr-admin.php:319 | |
| 125 | +msgid "Negative numbers are not allowed!" | |
| 126 | +msgstr "" | |
| 127 | + | |
| 128 | +#: legacy/admin/class-wpvr-admin.php:348 | |
| 129 | +msgid "Setup" | |
| 130 | +msgstr "budowa ciała" | |
| 131 | + | |
| 132 | +#: legacy/admin/class-wpvr-admin.php:350 | |
| 133 | +msgid "Tour Preview" | |
| 134 | +msgstr "Podgląd wycieczki" | |
| 135 | + | |
| 136 | +#: legacy/admin/class-wpvr-admin.php:352 | |
| 137 | +msgid "Checklist" | |
| 138 | +msgstr "" | |
| 139 | + | |
| 140 | +#: legacy/admin/class-wpvr-admin.php:369 | |
| 141 | +#: legacy/admin/classes/class-wpvr-admin-pages.php:70 | |
| 142 | +msgid "Get Started" | |
| 143 | +msgstr "rozpocząć" | |
| 144 | + | |
| 145 | +#: legacy/admin/class-wpvr-admin.php:374 | |
| 146 | +msgid "Documentation" | |
| 147 | +msgstr "dokumentacja" | |
| 148 | + | |
| 149 | +#: legacy/admin/class-wpvr-admin.php:381 | |
| 150 | +#: legacy/admin/classes/class-wpvr-admin-pages.php:104 | |
| 151 | +msgid "Go Pro" | |
| 152 | +msgstr "zostać pro" | |
| 153 | + | |
| 154 | +#: legacy/admin/class-wpvr-admin.php:695 | |
| 155 | +#, fuzzy | |
| 156 | +msgid "Import Tour" | |
| 157 | +msgstr "znaczyć" | |
| 158 | + | |
| 159 | +#: legacy/admin/class-wpvr-rollback.php:160 | |
| 160 | +msgid "WP VR Plugin Rollback" | |
| 161 | +msgstr "Wtyczka WP VR Wycofanie wtyczki" | |
| 162 | + | |
| 163 | +#: legacy/admin/classes/class-setup-meta-box.php:208 | |
| 164 | +#: legacy/admin/classes/class-wpvr-meta-field.php:119 | |
| 165 | +msgid "Video" | |
| 166 | +msgstr "wideo" | |
| 167 | + | |
| 168 | +#: legacy/admin/classes/class-tour-guide-translation.php:8 | |
| 169 | +msgid "Next" | |
| 170 | +msgstr "prawie" | |
| 171 | + | |
| 172 | +#: legacy/admin/classes/class-tour-guide-translation.php:9 | |
| 173 | +msgid "Previous" | |
| 174 | +msgstr "dawny" | |
| 175 | + | |
| 176 | +#: legacy/admin/classes/class-tour-guide-translation.php:10 | |
| 177 | +msgid "Done" | |
| 178 | +msgstr "spełniony" | |
| 179 | + | |
| 180 | +#: legacy/admin/classes/class-tour-guide-translation.php:11 | |
| 181 | +#, fuzzy | |
| 182 | +msgid "Skip Tour" | |
| 183 | +msgstr "wycieczka z przewodnikiem" | |
| 184 | + | |
| 185 | +#: legacy/admin/classes/class-tour-preview-meta-box.php:169 | |
| 186 | +#: legacy/admin/classes/class-tour-preview-meta-box.php:196 | |
| 187 | +#: legacy/admin/classes/class-tour-preview-meta-box.php:645 | |
| 188 | +msgid "Add This Position Into Active Hotspot" | |
| 189 | +msgstr "" | |
| 190 | + | |
| 191 | +#: legacy/admin/classes/class-tour-preview-meta-box.php:569 | |
| 192 | +msgid "PRO PREVIEW" | |
| 193 | +msgstr "" | |
| 194 | + | |
| 195 | +#: legacy/admin/classes/class-tour-preview-meta-box.php:584 | |
| 196 | +#: legacy/admin/classes/class-wpvr-meta-field.php:985 | |
| 197 | +msgid "Scene Gallery" | |
| 198 | +msgstr "Galeria scen" | |
| 199 | + | |
| 200 | +#: legacy/admin/classes/class-tour-preview-meta-box.php:593 | |
| 201 | +#, fuzzy | |
| 202 | +msgid "Scene 1" | |
| 203 | +msgstr "Identyfikator scen" | |
| 204 | + | |
| 205 | +#: legacy/admin/classes/class-tour-preview-meta-box.php:594 | |
| 206 | +#, fuzzy | |
| 207 | +msgid "Scene 2" | |
| 208 | +msgstr "Identyfikator scen" | |
| 209 | + | |
| 210 | +#: legacy/admin/classes/class-tour-preview-meta-box.php:595 | |
| 211 | +#, fuzzy | |
| 212 | +msgid "Scene 3" | |
| 213 | +msgstr "Identyfikator scen" | |
| 214 | + | |
| 215 | +#: legacy/admin/classes/class-tour-preview-meta-box.php:601 | |
| 216 | +#, fuzzy | |
| 217 | +msgid "Background Music" | |
| 218 | +msgstr "Muzyka w tle wycieczki" | |
| 219 | + | |
| 220 | +#: legacy/admin/classes/class-tour-preview-meta-box.php:606 | |
| 221 | +#, fuzzy | |
| 222 | +msgid "Gyroscope — Active on mobile" | |
| 223 | +msgstr "Powiadomienia o żyroskopie i urządzeniach mobilnych" | |
| 224 | + | |
| 225 | +#: legacy/admin/classes/class-tour-preview-meta-box.php:944 | |
| 226 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3307 | |
| 227 | +msgid "Preview" | |
| 228 | +msgstr "prapremiera" | |
| 229 | + | |
| 230 | +#: legacy/admin/classes/class-wpvr-admin-pages.php:73 | |
| 231 | +#: legacy/admin/classes/class-wpvr-post-type.php:363 | |
| 232 | +#: legacy/admin/classes/class-wpvr-post-type.php:364 | |
| 233 | +msgid "Tours" | |
| 234 | +msgstr "wycieczki" | |
| 235 | + | |
| 236 | +#: legacy/admin/classes/class-wpvr-admin-pages.php:75 | |
| 237 | +#: legacy/admin/classes/class-wpvr-post-type.php:365 | |
| 238 | +#: legacy/admin/classes/class-wpvr-post-type.php:366 src/Admin/Admin.php:58 | |
| 239 | +#: src/Admin/Admin.php:234 src/Admin/Admin.php:357 | |
| 106 | 240 | msgid "Add New Tour" |
| 241 | +msgstr "Dodaj nową wycieczkę" | |
| 242 | + | |
| 243 | +#: legacy/admin/classes/class-wpvr-admin-pages.php:87 | |
| 244 | +#: legacy/admin/classes/class-wpvr-meta-field.php:110 | |
| 245 | +msgid "Settings" | |
| 246 | +msgstr "Ustawienie" | |
| 247 | + | |
| 248 | +#: legacy/admin/classes/class-wpvr-admin-pages.php:92 | |
| 249 | +#: legacy/admin/partials/wpvr_documentation.php:22 | |
| 250 | +msgid "Free vs Pro" | |
| 251 | +msgstr "darmowe vs pro" | |
| 252 | + | |
| 253 | +#: legacy/admin/classes/class-wpvr-admin-pages.php:95 | |
| 254 | +msgid "Setup Wizard" | |
| 107 | 255 | msgstr "" |
| 108 | 256 | |
| 109 | -#: admin/classes/class-tour-guide-translation.php:16 | |
| 110 | -msgid "Add Scene ID " | |
| 257 | +#: legacy/admin/classes/class-wpvr-ajax.php:691 | |
| 258 | +#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:635 | |
| 259 | +msgid "Permission check failed" | |
| 260 | +msgstr "Sprawdzanie uprawnień nie powi" | |
| 261 | + | |
| 262 | +#: legacy/admin/classes/class-wpvr-ajax.php:728 | |
| 263 | +msgid "Email is required" | |
| 111 | 264 | msgstr "" |
| 112 | 265 | |
| 113 | -#: admin/partials/wpvr_setup_wizard.php:193 | |
| 114 | -msgid "Add-ons" | |
| 266 | +#: legacy/admin/classes/class-wpvr-ajax.php:730 | |
| 267 | +msgid "Email is invalid" | |
| 115 | 268 | msgstr "" |
| 116 | 269 | |
| 117 | -#: admin/classes/class-wpvr-meta-field.php:1318 | |
| 118 | -msgid "Advanced Controls" | |
| 270 | +#: legacy/admin/classes/class-wpvr-ajax.php:740 | |
| 271 | +msgid "Contact created successfully" | |
| 119 | 272 | msgstr "" |
| 120 | 273 | |
| 121 | -#: admin/partials/wpvr_documentation.php:831 | |
| 274 | +#: legacy/admin/classes/class-wpvr-ajax.php:742 | |
| 275 | +msgid "Failed to create contact" | |
| 276 | +msgstr "" | |
| 277 | + | |
| 278 | +#: legacy/admin/classes/class-wpvr-ajax.php:776 | |
| 279 | +msgid "General setting data successfully saved." | |
| 280 | +msgstr "" | |
| 281 | + | |
| 282 | +#: legacy/admin/classes/class-wpvr-ajax.php:821 | |
| 283 | +msgid "Opt-in value saved." | |
| 284 | +msgstr "" | |
| 285 | + | |
| 286 | +#. translators: %s: url to publish first tour | |
| 287 | +#: legacy/admin/classes/class-wpvr-first-tour-banner.php:112 | |
| 288 | +#, php-format | |
| 122 | 289 | msgid "" |
| 123 | -"Allow the Authors of your site to Create, Edit, Update, and Delete virtual " | |
| 124 | -"tours (They can access their own tours only):" | |
| 290 | +"You haven't published your first tour yet. <a href=\"%s\">Publish your first " | |
| 291 | +"tour</a> and see it live in minutes!" | |
| 125 | 292 | msgstr "" |
| 126 | 293 | |
| 127 | -#: admin/partials/wpvr_documentation.php:806 | |
| 294 | +#. translators: %s: url to upgrade to pro | |
| 295 | +#: legacy/admin/classes/class-wpvr-first-tour-banner.php:127 | |
| 296 | +#, php-format | |
| 128 | 297 | msgid "" |
| 129 | -"Allow the Editors of your site to Create, Edit, Update, and Delete virtual " | |
| 130 | -"tours (They can access other users' tours):" | |
| 298 | +"You've published your first tour! <a href=\"%s\" target=\"_blank\" rel=" | |
| 299 | +"\"noopener\">Upgrade to Pro</a> for unlimited tours, hotspots, and advanced " | |
| 300 | +"features!" | |
| 131 | 301 | msgstr "" |
| 132 | 302 | |
| 133 | -#: admin/classes/class-tour-guide-translation.php:54 | |
| 134 | -msgid "Assign Pitch & Yaw" | |
| 303 | +#: legacy/admin/classes/class-wpvr-general.php:78 | |
| 304 | +#: legacy/admin/classes/class-wpvr-shortcode.php:32 | |
| 305 | +msgid "Using this Tour" | |
| 306 | +msgstr "Korzystanie z tej wycieczki" | |
| 307 | + | |
| 308 | +#: legacy/admin/classes/class-wpvr-general.php:84 | |
| 309 | +msgid "To Embed on External Page:" | |
| 310 | +msgstr "Aby osadzić na zewnętrznej stronie:" | |
| 311 | + | |
| 312 | +#: legacy/admin/classes/class-wpvr-general.php:88 | |
| 313 | +msgid "Use the iframe below to share this tour on an external page." | |
| 135 | 314 | msgstr "" |
| 315 | +"Użyj poniższej iframe, aby udostępnić tę wycieczkę na zewnętrznej stronie." | |
| 136 | 316 | |
| 137 | -#: admin/partials/wpvr_documentation.php:852 | |
| 317 | +#: legacy/admin/classes/class-wpvr-general.php:90 | |
| 138 | 318 | msgid "" |
| 139 | -"Authors will be able to Create, Edit, Update, and Delete their own virtual " | |
| 140 | -"tours only." | |
| 319 | +"Note: WooCommerce & Fluent Forms hotspots will not be supported on " | |
| 320 | +"embedded tours." | |
| 141 | 321 | msgstr "" |
| 322 | +"Uwaga: Hotspoty WooCommerce & Amp; Fluent Forms Hotspoty nie będą " | |
| 323 | +"obsługiwane podczas wycieczek osadzonych." | |
| 142 | 324 | |
| 143 | -#: admin/classes/class-wpvr-meta-field.php:680 | |
| 144 | -msgid "Auto Gyroscope Support" | |
| 325 | +#: legacy/admin/classes/class-wpvr-general.php:105 | |
| 326 | +msgid "Share your tour" | |
| 327 | +msgstr "Udostępnij swoją wycieczkę" | |
| 328 | + | |
| 329 | +#: legacy/admin/classes/class-wpvr-general.php:110 | |
| 330 | +msgid "Enable Social Media Share" | |
| 331 | +msgstr "Włącz udostępnianie w mediach społecznościowych" | |
| 332 | + | |
| 333 | +#: legacy/admin/classes/class-wpvr-general.php:127 | |
| 334 | +msgid "Create a tour use this QR code" | |
| 335 | +msgstr "Utwórz wycieczkę Użyj tego kodu QR" | |
| 336 | + | |
| 337 | +#: legacy/admin/classes/class-wpvr-general.php:132 | |
| 338 | +msgid "Download QR Code" | |
| 339 | +msgstr "pobierz kod QR" | |
| 340 | + | |
| 341 | +#: legacy/admin/classes/class-wpvr-hotspot.php:109 | |
| 342 | +#: legacy/admin/classes/class-wpvr-hotspot.php:169 | |
| 343 | +#, fuzzy | |
| 344 | +msgid "Hotspot Settings" | |
| 345 | +msgstr "Ustawienie hotspotu" | |
| 346 | + | |
| 347 | +#: legacy/admin/classes/class-wpvr-meta-field.php:92 | |
| 348 | +msgid "Scenes" | |
| 349 | +msgstr "scenki" | |
| 350 | + | |
| 351 | +#: legacy/admin/classes/class-wpvr-meta-field.php:101 | |
| 352 | +msgid "Hotspot" | |
| 353 | +msgstr "gorący miejsce" | |
| 354 | + | |
| 355 | +#: legacy/admin/classes/class-wpvr-meta-field.php:135 | |
| 356 | +#: legacy/admin/classes/class-wpvr-meta-field.php:830 | |
| 357 | +msgid "Floor Plan" | |
| 145 | 358 | msgstr "" |
| 146 | 359 | |
| 147 | -#: admin/classes/class-wpvr-meta-field.php:218 | |
| 148 | -msgid "Auto Rotation" | |
| 360 | +#: legacy/admin/classes/class-wpvr-meta-field.php:147 | |
| 361 | +#: legacy/admin/classes/class-wpvr-meta-field.php:839 | |
| 362 | +#: legacy/admin/classes/class-wpvr-post-type.php:160 | |
| 363 | +#, fuzzy | |
| 364 | +msgid "Background Tour" | |
| 365 | +msgstr "Kolor tła" | |
| 366 | + | |
| 367 | +#: legacy/admin/classes/class-wpvr-meta-field.php:159 | |
| 368 | +#: legacy/admin/classes/class-wpvr-meta-field.php:848 | |
| 369 | +#: legacy/admin/classes/class-wpvr-post-type.php:143 src/Admin/Admin.php:556 | |
| 370 | +#, fuzzy | |
| 371 | +msgid "Street View" | |
| 372 | +msgstr "Widok ulicy Google" | |
| 373 | + | |
| 374 | +#: legacy/admin/classes/class-wpvr-meta-field.php:212 | |
| 375 | +msgid "Set a Tour Preview Image" | |
| 376 | +msgstr "Ustaw obraz podglądu wycieczki" | |
| 377 | + | |
| 378 | +#: legacy/admin/classes/class-wpvr-meta-field.php:215 | |
| 379 | +msgid "" | |
| 380 | +"Upload an image that will be shown as the preview before the tour starts." | |
| 149 | 381 | msgstr "" |
| 150 | 382 | |
| 151 | -#: admin/partials/wpvr_documentation.php:742 | |
| 152 | -msgid "Autoload & Autoplay Video Tours." | |
| 383 | +#: legacy/admin/classes/class-wpvr-meta-field.php:224 | |
| 384 | +msgid "Preview Image Message" | |
| 385 | +msgstr "Wyświetl wiadomość obrazkową" | |
| 386 | + | |
| 387 | +#: legacy/admin/classes/class-wpvr-meta-field.php:226 | |
| 388 | +msgid "Add a custom message that appears alongside the tour preview image." | |
| 153 | 389 | msgstr "" |
| 154 | 390 | |
| 155 | -#: admin/partials/wpvr_documentation.php:540 | |
| 156 | -msgid "Autoload Tours" | |
| 391 | +#: legacy/admin/classes/class-wpvr-meta-field.php:234 | |
| 392 | +msgid "Tour Autoload" | |
| 393 | +msgstr "Automatyczne ładowanie wycieczki" | |
| 394 | + | |
| 395 | +#: legacy/admin/classes/class-wpvr-meta-field.php:238 | |
| 396 | +msgid "" | |
| 397 | +"Automatically start the tour when the page is loaded without displaying the " | |
| 398 | +"preview image." | |
| 157 | 399 | msgstr "" |
| 158 | 400 | |
| 159 | -#: admin/partials/wpvr_setup_wizard.php:8 | |
| 160 | -msgid "Back to WPVR Dashboard" | |
| 401 | +#: legacy/admin/classes/class-wpvr-meta-field.php:286 | |
| 402 | +msgid "Basic Control Buttons" | |
| 403 | +msgstr "Podstawowe przyciski sterowania" | |
| 404 | + | |
| 405 | +#: legacy/admin/classes/class-wpvr-meta-field.php:290 | |
| 406 | +msgid "" | |
| 407 | +"Enable basic navigation buttons like play, pause, and reset for easier " | |
| 408 | +"control of the tour." | |
| 161 | 409 | msgstr "" |
| 162 | 410 | |
| 163 | -#: admin/partials/wpvr_setup_wizard.php:169 | |
| 164 | -msgid "Background Audio" | |
| 411 | +#: legacy/admin/classes/class-wpvr-meta-field.php:297 | |
| 412 | +msgid "Scene Fade Duration" | |
| 413 | +msgstr "Czas trwania zanikania sceny" | |
| 414 | + | |
| 415 | +#: legacy/admin/classes/class-wpvr-meta-field.php:303 | |
| 416 | +msgid "Set the duration (in milliseconds) for the fade effect between scenes." | |
| 165 | 417 | msgstr "" |
| 166 | 418 | |
| 167 | -#: admin/classes/class-wpvr-meta-field.php:3032 | |
| 168 | -msgid "Background Color" | |
| 419 | +#: legacy/admin/classes/class-wpvr-meta-field.php:309 | |
| 420 | +msgid "Auto Rotation" | |
| 421 | +msgstr "Obrót automatyczny" | |
| 422 | + | |
| 423 | +#: legacy/admin/classes/class-wpvr-meta-field.php:315 | |
| 424 | +msgid "" | |
| 425 | +"Enable automatic rotation of the tour for continuous movement without user " | |
| 426 | +"interaction." | |
| 169 | 427 | msgstr "" |
| 170 | 428 | |
| 171 | -#: admin/partials/wpvr_documentation.php:677 | |
| 172 | -msgid "Background Panoramas" | |
| 429 | +#: legacy/admin/classes/class-wpvr-meta-field.php:328 | |
| 430 | +#, fuzzy | |
| 431 | +msgid "Control Access" | |
| 432 | +msgstr "Przyciski sterujące" | |
| 433 | + | |
| 434 | +#: legacy/admin/classes/class-wpvr-meta-field.php:336 | |
| 435 | +msgid "Restrict this tour to selected membership levels." | |
| 173 | 436 | msgstr "" |
| 174 | 437 | |
| 175 | -#: admin/classes/class-wpvr-meta-field.php:160 | |
| 176 | -msgid "Basic Control Buttons" | |
| 438 | +#: legacy/admin/classes/class-wpvr-meta-field.php:368 | |
| 439 | +msgid "Generic Form" | |
| 440 | +msgstr "Formularz ogólny" | |
| 441 | + | |
| 442 | +#: legacy/admin/classes/class-wpvr-meta-field.php:375 | |
| 443 | +msgid "Enable this to add a form to the tour for user interaction." | |
| 177 | 444 | msgstr "" |
| 178 | 445 | |
| 179 | -#: admin/classes/class-wpvr-meta-field.php:1309 | |
| 180 | -msgid "Basic Settings" | |
| 446 | +#: legacy/admin/classes/class-wpvr-meta-field.php:404 | |
| 447 | +msgid "Call To Action " | |
| 448 | +msgstr "wezwanie" | |
| 449 | + | |
| 450 | +#: legacy/admin/classes/class-wpvr-meta-field.php:411 | |
| 451 | +msgid "" | |
| 452 | +"Add a call-to-action button that prompts users to take action during the " | |
| 453 | +"tour." | |
| 181 | 454 | msgstr "" |
| 182 | 455 | |
| 183 | -#: admin/partials/wpvr_documentation.php:203 | |
| 456 | +#: legacy/admin/classes/class-wpvr-meta-field.php:441 | |
| 457 | +msgid "Custom CSS " | |
| 458 | +msgstr "Niestandardowe CSS" | |
| 459 | + | |
| 460 | +#: legacy/admin/classes/class-wpvr-meta-field.php:448 | |
| 184 | 461 | msgid "" |
| 185 | -"Before You start, you can check our Documentation to get familiar with WP VR " | |
| 186 | -"- 360 Panorama and virtual tour creator for WordPress." | |
| 462 | +"Add your own custom CSS styles to further personalize the look and feel of " | |
| 463 | +"the tour." | |
| 187 | 464 | msgstr "" |
| 188 | -"Zanim zaczniesz, możesz sprawdzić naszą dokumentację, aby zapoznać się z WP " | |
| 189 | -"VR - 360 Panorama i twórcą wirtualnej wycieczki dla WordPress." | |
| 190 | 465 | |
| 191 | -#: admin/partials/wpvr_setup_wizard.php:43 | |
| 192 | -msgid "Best WordPress Plugin" | |
| 466 | +#: legacy/admin/classes/class-wpvr-meta-field.php:538 | |
| 467 | +msgid "Rotation Speed and Direction" | |
| 468 | +msgstr "Prędkość obrotowa i kierunek" | |
| 469 | + | |
| 470 | +#: legacy/admin/classes/class-wpvr-meta-field.php:544 | |
| 471 | +msgid "" | |
| 472 | +"Set the rotation speed, with positive values for anti-clockwise rotation and " | |
| 473 | +"negative values for clockwise rotation." | |
| 193 | 474 | msgstr "" |
| 194 | 475 | |
| 195 | -#: admin/classes/class-wpvr-meta-field.php:3118 | |
| 196 | -msgid "Border" | |
| 476 | +#: legacy/admin/classes/class-wpvr-meta-field.php:550 | |
| 477 | +msgid "Resume Auto-rotation after" | |
| 478 | +msgstr "Wznów automatyczne obracanie po" | |
| 479 | + | |
| 480 | +#: legacy/admin/classes/class-wpvr-meta-field.php:556 | |
| 481 | +msgid "" | |
| 482 | +"Define the time (in milliseconds) after which auto-rotation will resume once " | |
| 483 | +"the user clicks on the tour." | |
| 197 | 484 | msgstr "" |
| 198 | 485 | |
| 199 | -#: admin/classes/class-wpvr-meta-field.php:3113 | |
| 200 | -msgid "Border Radius (px)" | |
| 486 | +#: legacy/admin/classes/class-wpvr-meta-field.php:562 | |
| 487 | +msgid "Stop Auto-rotation after" | |
| 488 | +msgstr "Zatrzymaj automatyczne obracanie po" | |
| 489 | + | |
| 490 | +#: legacy/admin/classes/class-wpvr-meta-field.php:568 | |
| 491 | +msgid "" | |
| 492 | +"Set the time (in milliseconds) after which the auto-rotation will stop " | |
| 493 | +"automatically." | |
| 201 | 494 | msgstr "" |
| 202 | 495 | |
| 203 | -#: admin/classes/class-wpvr-meta-field.php:3156 | |
| 204 | -msgid "Bottom" | |
| 496 | +#: legacy/admin/classes/class-wpvr-meta-field.php:590 | |
| 497 | +msgid "Select Transition Style" | |
| 205 | 498 | msgstr "" |
| 206 | 499 | |
| 207 | -#: admin/classes/class-wpvr-meta-field.php:3084 | |
| 208 | -msgid "Button Alignment" | |
| 500 | +#: legacy/admin/classes/class-wpvr-meta-field.php:598 | |
| 501 | +msgid "This will set the scene fade effect and execution time." | |
| 502 | +msgstr "Spowoduje to ustawienie efektu zanikania sceny i czasu wykonania." | |
| 503 | + | |
| 504 | +#: legacy/admin/classes/class-wpvr-meta-field.php:604 | |
| 505 | +#, fuzzy | |
| 506 | +msgid "Scene Transition Duration (ms)" | |
| 507 | +msgstr "Czas trwania zanikania sceny" | |
| 508 | + | |
| 509 | +#: legacy/admin/classes/class-wpvr-meta-field.php:612 | |
| 510 | +msgid "" | |
| 511 | +"Set the duration for scene transition animations in milliseconds (default: " | |
| 512 | +"500 ms)." | |
| 209 | 513 | msgstr "" |
| 210 | 514 | |
| 211 | -#: admin/classes/class-wpvr-meta-field.php:460 | |
| 212 | -msgid "Button Style" | |
| 515 | +#: legacy/admin/classes/class-wpvr-meta-field.php:619 | |
| 516 | +msgid "Add Animation Delay (ms)" | |
| 213 | 517 | msgstr "" |
| 214 | 518 | |
| 215 | -#: admin/classes/class-wpvr-meta-field.php:443 | |
| 519 | +#: legacy/admin/classes/class-wpvr-meta-field.php:628 | |
| 520 | +msgid "" | |
| 521 | +"Set the delay before the scene transition animation starts (default: 0 ms)." | |
| 522 | +msgstr "" | |
| 523 | + | |
| 524 | +#: legacy/admin/classes/class-wpvr-meta-field.php:640 | |
| 525 | +msgid "Add Form Shortcode" | |
| 526 | +msgstr "Dodaj krótki kod formularza" | |
| 527 | + | |
| 528 | +#: legacy/admin/classes/class-wpvr-meta-field.php:646 | |
| 529 | +#, fuzzy | |
| 530 | +msgid "Insert the shortcode for the form you want to display in the tour." | |
| 531 | +msgstr "Wydrukuj formularze Shortcode, które chcesz wyświetlić." | |
| 532 | + | |
| 533 | +#: legacy/admin/classes/class-wpvr-meta-field.php:659 | |
| 216 | 534 | msgid "Button Text" |
| 535 | +msgstr "Tekst przycisku" | |
| 536 | + | |
| 537 | +#: legacy/admin/classes/class-wpvr-meta-field.php:665 | |
| 538 | +msgid "Customize the text displayed on the call-to-action button." | |
| 217 | 539 | msgstr "" |
| 218 | 540 | |
| 219 | -#: admin/classes/class-wpvr-meta-field.php:451 | |
| 541 | +#: legacy/admin/classes/class-wpvr-meta-field.php:671 | |
| 220 | 542 | msgid "Button URL" |
| 543 | +msgstr "Adres URL przycisku" | |
| 544 | + | |
| 545 | +#: legacy/admin/classes/class-wpvr-meta-field.php:677 | |
| 546 | +msgid "" | |
| 547 | +"Set the link the call-to-action button will direct users to when clicked." | |
| 221 | 548 | msgstr "" |
| 222 | 549 | |
| 223 | -#: admin/classes/class-wpvr-meta-field.php:276 | |
| 224 | -msgid "Call To Action " | |
| 550 | +#: legacy/admin/classes/class-wpvr-meta-field.php:683 | |
| 551 | +msgid "Button Style" | |
| 552 | +msgstr "Styl przycisku" | |
| 553 | + | |
| 554 | +#: legacy/admin/classes/class-wpvr-meta-field.php:689 | |
| 555 | +msgid "Print the forms shortcode you want to show." | |
| 556 | +msgstr "Wydrukuj formularze Shortcode, które chcesz wyświetlić." | |
| 557 | + | |
| 558 | +#: legacy/admin/classes/class-wpvr-meta-field.php:700 | |
| 559 | +msgid "Custom CSS" | |
| 560 | +msgstr "Niestandardowe CSS" | |
| 561 | + | |
| 562 | +#: legacy/admin/classes/class-wpvr-meta-field.php:826 | |
| 563 | +#: legacy/admin/classes/class-wpvr-meta-field.php:835 | |
| 564 | +#: legacy/admin/classes/class-wpvr-meta-field.php:844 | |
| 565 | +#: legacy/admin/classes/class-wpvr-meta-field.php:853 | |
| 566 | +#: legacy/admin/classes/class-wpvr-post-type.php:147 | |
| 567 | +#: legacy/admin/classes/class-wpvr-post-type.php:164 | |
| 568 | +#: legacy/admin/partials/wpvr_documentation.php:95 | |
| 569 | +msgid "pro" | |
| 570 | +msgstr "zawodowiec" | |
| 571 | + | |
| 572 | +#: legacy/admin/classes/class-wpvr-meta-field.php:857 | |
| 573 | +#: legacy/admin/classes/class-wpvr-meta-field.php:870 | |
| 574 | +msgid "Export" | |
| 575 | +msgstr "eksportowy" | |
| 576 | + | |
| 577 | +#: legacy/admin/classes/class-wpvr-meta-field.php:894 | |
| 578 | +msgid "Keyboard Movement Control" | |
| 579 | +msgstr "Kontrola ruchu klawiatury" | |
| 580 | + | |
| 581 | +#: legacy/admin/classes/class-wpvr-meta-field.php:898 | |
| 582 | +msgid "Use arrow keys or WASD keys to move through the virtual tour." | |
| 225 | 583 | msgstr "" |
| 226 | 584 | |
| 227 | -#: admin/classes/class-wpvr-meta-field.php:448 | |
| 228 | -msgid "Call to action button text" | |
| 585 | +#: legacy/admin/classes/class-wpvr-meta-field.php:905 | |
| 586 | +msgid "Keyboard Zoom Control" | |
| 587 | +msgstr "Kontrola zoomu klawiatury" | |
| 588 | + | |
| 589 | +#: legacy/admin/classes/class-wpvr-meta-field.php:909 | |
| 590 | +msgid "Zoom in and out of the virtual tour using keyboard shortcuts." | |
| 229 | 591 | msgstr "" |
| 230 | 592 | |
| 231 | -#: admin/partials/wpvr_documentation.php:212 | |
| 593 | +#: legacy/admin/classes/class-wpvr-meta-field.php:916 | |
| 594 | +msgid "Mouse Drag Control" | |
| 595 | +msgstr "Kontrola przeciągania myszy" | |
| 596 | + | |
| 597 | +#: legacy/admin/classes/class-wpvr-meta-field.php:920 | |
| 232 | 598 | msgid "" |
| 233 | -"Can't find solution on with our documentation? Just Post a ticket on Support " | |
| 234 | -"forum. We are to solve your issue." | |
| 599 | +"Click and drag with your mouse to look around and navigate the virtual tour." | |
| 235 | 600 | msgstr "" |
| 236 | -"Nie możesz znaleźć rozwiązania w naszej dokumentacji? Wystarczy opublikować " | |
| 237 | -"bilet na forum pomocy technicznej. Mamy rozwiązać Twój problem." | |
| 238 | 601 | |
| 239 | -#: admin/classes/class-wpvr-meta-field.php:3079 | |
| 240 | -msgid "Capitalize" | |
| 602 | +#: legacy/admin/classes/class-wpvr-meta-field.php:927 | |
| 603 | +msgid "Mouse Zoom Control" | |
| 604 | +msgstr "Kontrola zoomu myszy" | |
| 605 | + | |
| 606 | +#: legacy/admin/classes/class-wpvr-meta-field.php:931 | |
| 607 | +msgid "" | |
| 608 | +"Use your mouse wheel to zoom in and out smoothly within the virtual tour." | |
| 241 | 609 | msgstr "" |
| 242 | 610 | |
| 243 | -#: admin/partials/wpvr_documentation.php:243 | |
| 244 | -msgid "Cart Lift" | |
| 611 | +#: legacy/admin/classes/class-wpvr-meta-field.php:938 | |
| 612 | +msgid "Gyroscope Control" | |
| 613 | +msgstr "Sterowanie żyroskopem" | |
| 614 | + | |
| 615 | +#: legacy/admin/classes/class-wpvr-meta-field.php:942 | |
| 616 | +msgid "" | |
| 617 | +"Move your mobile device to explore the tour using built-in motion sensors." | |
| 245 | 618 | msgstr "" |
| 246 | 619 | |
| 247 | -#: admin/classes/class-wpvr-meta-field.php:3088 | |
| 248 | -msgid "Center" | |
| 620 | +#: legacy/admin/classes/class-wpvr-meta-field.php:949 | |
| 621 | +msgid "Auto Gyroscope Support" | |
| 622 | +msgstr "Obsługa żyroskopu samochodowego" | |
| 623 | + | |
| 624 | +#: legacy/admin/classes/class-wpvr-meta-field.php:953 | |
| 625 | +msgid "" | |
| 626 | +"Automatically activate device orientation control if enabled, or manually " | |
| 627 | +"trigger it with a button." | |
| 249 | 628 | msgstr "" |
| 250 | 629 | |
| 251 | -#: admin/partials/wpvr_documentation.php:228 | |
| 252 | -msgid "Check out our other amazing free plugins!" | |
| 630 | +#: legacy/admin/classes/class-wpvr-meta-field.php:960 | |
| 631 | +msgid "Compass" | |
| 632 | +msgstr "opasanie" | |
| 633 | + | |
| 634 | +#: legacy/admin/classes/class-wpvr-meta-field.php:964 | |
| 635 | +msgid "" | |
| 636 | +"Display a directional guide to keep track of your orientation while " | |
| 637 | +"navigating the virtual tour." | |
| 253 | 638 | msgstr "" |
| 254 | 639 | |
| 255 | -#: admin/partials/wpvr_setup_wizard.php:189 | |
| 256 | -msgid "Checkout All Features" | |
| 640 | +#: legacy/admin/classes/class-wpvr-meta-field.php:990 | |
| 641 | +msgid "" | |
| 642 | +"Show a gallery of all scenes, allowing users to easily navigate by clicking " | |
| 643 | +"on thumbnails." | |
| 257 | 644 | msgstr "" |
| 258 | 645 | |
| 259 | -#: admin/classes/class-tour-guide-translation.php:50 | |
| 260 | -msgid "Choose The Spot" | |
| 646 | +#: legacy/admin/classes/class-wpvr-meta-field.php:996 | |
| 647 | +msgid "Scene Titles on Gallery" | |
| 648 | +msgstr "Tytuły scen w galerii" | |
| 649 | + | |
| 650 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1001 | |
| 651 | +#, fuzzy | |
| 652 | +msgid "" | |
| 653 | +"Display scene titles on each thumbnail in the Scene Gallery for better " | |
| 654 | +"identification." | |
| 261 | 655 | msgstr "" |
| 656 | +"Włączenie go spowoduje wyświetlenie tytułów scen na każdej miniaturze sceny " | |
| 657 | +"w galerii sceny. Identyfikatory scen będą używane jako tytuł sceny." | |
| 262 | 658 | |
| 263 | -#: admin/classes/class-tour-guide-translation.php:75 | |
| 264 | -msgid "Click on Preview to see how the content is appearing for the hotspot." | |
| 659 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1007 | |
| 660 | +msgid "Scene Navigation Menu" | |
| 661 | +msgstr "Menu nawigacji sceny" | |
| 662 | + | |
| 663 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1012 | |
| 664 | +msgid "" | |
| 665 | +"Enable a menu to navigate through all scenes, allowing users to jump to a " | |
| 666 | +"specific scene." | |
| 265 | 667 | msgstr "" |
| 266 | 668 | |
| 267 | -#: admin/classes/class-tour-guide-translation.php:26 | |
| 669 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1018 | |
| 670 | +msgid "Tour Background Music" | |
| 671 | +msgstr "Muzyka w tle wycieczki" | |
| 672 | + | |
| 673 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1023 | |
| 674 | +msgid "Add background music to your tour to enhance the user experience." | |
| 675 | +msgstr "" | |
| 676 | + | |
| 677 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1029 | |
| 678 | +msgid "Enable explainer video" | |
| 679 | +msgstr "Włącz wideo wyjaśniające" | |
| 680 | + | |
| 681 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1033 | |
| 268 | 682 | msgid "" |
| 269 | -"Click on the Preview button to view your uploaded panorama in virtual tour " | |
| 270 | -"mode." | |
| 683 | +"Add an explainer video to the tour, providing additional context or details " | |
| 684 | +"for users." | |
| 271 | 685 | msgstr "" |
| 272 | 686 | |
| 273 | -#: admin/classes/class-tour-guide-translation.php:79 | |
| 687 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1040 | |
| 688 | +msgid "Set Zoom Preferences" | |
| 689 | +msgstr "Ustaw preferencje powiększenia" | |
| 690 | + | |
| 691 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1044 | |
| 274 | 692 | msgid "" |
| 275 | -"Click on the Update button to save your work. And just like that, you can " | |
| 276 | -"create an unlimited number of virtual tours and add your customization to " | |
| 277 | -"them." | |
| 693 | +"Customize the zoom level for your tour, with options to adjust the view " | |
| 694 | +"between 50 to 120 degrees." | |
| 278 | 695 | msgstr "" |
| 279 | 696 | |
| 280 | -#: admin/classes/class-tour-guide-translation.php:21 | |
| 281 | -msgid "Click on the Upload button to upload your panorama image." | |
| 697 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1051 | |
| 698 | +msgid "Add Company Information" | |
| 699 | +msgstr "Dodaj informacje o firmie" | |
| 700 | + | |
| 701 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1056 | |
| 702 | +msgid "" | |
| 703 | +"Include your company logo and details within the tour to brand the " | |
| 704 | +"experience." | |
| 282 | 705 | msgstr "" |
| 283 | 706 | |
| 284 | -#: admin/classes/class-tour-guide-translation.php:34 | |
| 285 | -msgid "" | |
| 286 | -"Click on this Publish button to save this as a tour. You can always find it " | |
| 287 | -"in your tour list." | |
| 707 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1078 | |
| 708 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1148 | |
| 709 | +msgid "Scene Type" | |
| 710 | +msgstr "Typ sceny" | |
| 711 | + | |
| 712 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1085 | |
| 713 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1155 | |
| 714 | +msgid "Choose the type of scene, such as Equirectangular or Cubemap." | |
| 288 | 715 | msgstr "" |
| 289 | 716 | |
| 290 | -#: admin/classes/class-wpvr-meta-field.php:2264 | |
| 291 | -msgid "Click to Upload an Image " | |
| 717 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1091 | |
| 718 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1160 | |
| 719 | +msgid "Scene Upload" | |
| 720 | +msgstr "Przesyłanie sceny" | |
| 721 | + | |
| 722 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1097 | |
| 723 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1166 | |
| 724 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2275 | |
| 725 | +msgid "Upload an image to be used as the scene media (video is not supported)." | |
| 292 | 726 | msgstr "" |
| 293 | 727 | |
| 294 | -#: admin/classes/class-wpvr-meta-field.php:3137 | |
| 295 | -msgid "Color" | |
| 728 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1103 | |
| 729 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1172 | |
| 730 | +msgid "Set as Default" | |
| 731 | +msgstr "Ustaw jako domyślny" | |
| 732 | + | |
| 733 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1109 | |
| 734 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1178 | |
| 735 | +msgid "Make this scene the first one that appears when the tour loads." | |
| 296 | 736 | msgstr "" |
| 297 | 737 | |
| 298 | -#: admin/partials/wpvr_documentation.php:593 | |
| 299 | -msgid "Company Logo & Description" | |
| 738 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1115 | |
| 739 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1184 | |
| 740 | +msgid "Scene ID" | |
| 741 | +msgstr "Identyfikator scen" | |
| 742 | + | |
| 743 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1122 | |
| 744 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1191 | |
| 745 | +msgid "Unique identifier for the scene, auto-generated if left empty." | |
| 300 | 746 | msgstr "" |
| 301 | 747 | |
| 302 | -#: admin/classes/class-wpvr-meta-field.php:688 | |
| 303 | -msgid "Compass" | |
| 748 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1211 | |
| 749 | +msgid "Hotspot ID" | |
| 750 | +msgstr "Identyfikator hotspotu" | |
| 751 | + | |
| 752 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1218 | |
| 753 | +msgid "A unique identifier for the hotspot, auto-generated if left empty." | |
| 304 | 754 | msgstr "" |
| 305 | 755 | |
| 306 | -#: admin/partials/wpvr_setup_wizard.php:217 | |
| 307 | -msgid "Contact Our Support" | |
| 756 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1224 | |
| 757 | +msgid "Pitch" | |
| 758 | +msgstr "wystawiać towar" | |
| 759 | + | |
| 760 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1231 | |
| 761 | +msgid "Set the pitch angle for the hotspot’s vertical position in the scene." | |
| 308 | 762 | msgstr "" |
| 309 | 763 | |
| 310 | -#: admin/classes/class-tour-guide-translation.php:23 | |
| 311 | -msgid "Continue to guide" | |
| 764 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1236 | |
| 765 | +msgid "Yaw" | |
| 766 | +msgstr "schodzić z kursu" | |
| 767 | + | |
| 768 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1243 | |
| 769 | +msgid "Set the yaw angle for the hotspot’s horizontal position in the scene." | |
| 312 | 770 | msgstr "" |
| 313 | 771 | |
| 314 | -#: admin/classes/class-wpvr-meta-field.php:1327 | |
| 315 | -msgid "Control Buttons" | |
| 772 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1248 | |
| 773 | +msgid "Hotspot Custom Icon Class" | |
| 774 | +msgstr "Niestandardowa klasa ikon Hotspot" | |
| 775 | + | |
| 776 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1255 | |
| 777 | +msgid "Add a custom CSS class for the hotspot icon." | |
| 316 | 778 | msgstr "" |
| 317 | 779 | |
| 318 | -#: admin/partials/wpvr_documentation.php:635 | |
| 319 | -msgid "Control Horizontal & Vertical View of Panorama Images" | |
| 780 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1274 | |
| 781 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1360 | |
| 782 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1452 | |
| 783 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1518 | |
| 784 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1584 | |
| 785 | +msgid "Hotspot-Type" | |
| 786 | +msgstr "Hotspot-typ" | |
| 787 | + | |
| 788 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1278 | |
| 789 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1364 | |
| 790 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1462 | |
| 791 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1528 | |
| 792 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1588 | |
| 793 | +msgid "URL" | |
| 794 | +msgstr "URL" | |
| 795 | + | |
| 796 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1284 | |
| 797 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1370 | |
| 798 | +msgid "Provide a URL that the hotspot will link to when clicked." | |
| 320 | 799 | msgstr "" |
| 321 | 800 | |
| 322 | -#: admin/partials/wpvr_documentation.php:1105 | |
| 323 | -msgid "Convert any jpeg or png format image to webp on media upload:" | |
| 801 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1289 | |
| 802 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1375 | |
| 803 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1468 | |
| 804 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1534 | |
| 805 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1594 | |
| 806 | +msgid "Open in same tab" | |
| 807 | +msgstr "Otwórz w tej samej karcie" | |
| 808 | + | |
| 809 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1295 | |
| 810 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1381 | |
| 811 | +msgid "Choose whether the URL opens in the same tab or a new tab." | |
| 324 | 812 | msgstr "" |
| 325 | 813 | |
| 326 | -#: admin/classes/class-wpvr-general.php:138 | |
| 327 | -msgid "Create a tour use this QR code" | |
| 814 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1301 | |
| 815 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1387 | |
| 816 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1475 | |
| 817 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1541 | |
| 818 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1601 | |
| 819 | +msgid "On Click Content" | |
| 820 | +msgstr "Przy kliknięciu treści" | |
| 821 | + | |
| 822 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1305 | |
| 823 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1393 | |
| 824 | +msgid "Add custom content or actions that occur when the hotspot is clicked." | |
| 328 | 825 | msgstr "" |
| 329 | 826 | |
| 330 | -#: admin/partials/wpvr_documentation.php:234 | |
| 827 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1311 | |
| 828 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1399 | |
| 829 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1482 | |
| 830 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1548 | |
| 831 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1607 | |
| 832 | +msgid "On Hover Content" | |
| 833 | +msgstr "Na najechaniu zawartości" | |
| 834 | + | |
| 835 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1315 | |
| 836 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1405 | |
| 331 | 837 | msgid "" |
| 332 | -"Create high-converting slaes funnels on a visual drag & drop funnel builder " | |
| 333 | -"canvas and increase your online sales from today." | |
| 838 | +"Add custom content or actions that appear when the user hovers over the " | |
| 839 | +"hotspot." | |
| 334 | 840 | msgstr "" |
| 335 | 841 | |
| 336 | -#: admin/classes/class-wpvr-meta-field.php:1677 | |
| 337 | -msgid "Cubemap" | |
| 842 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1320 | |
| 843 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1410 | |
| 844 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1488 | |
| 845 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1554 | |
| 846 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1613 | |
| 847 | +msgid "Select Target Scene from List" | |
| 848 | +msgstr "Wybierz scenę docelową z listy" | |
| 849 | + | |
| 850 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1324 | |
| 851 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1415 | |
| 852 | +msgid "Choose the target scene for the hotspot to navigate to." | |
| 338 | 853 | msgstr "" |
| 339 | 854 | |
| 340 | -#: admin/partials/wpvr_documentation.php:499 | |
| 341 | -msgid "Cubemap Image Support" | |
| 855 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1329 | |
| 856 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1420 | |
| 857 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1493 | |
| 858 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1559 | |
| 859 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1618 | |
| 860 | +msgid "Target Scene ID" | |
| 861 | +msgstr "Identyfikator sceny docelowe" | |
| 862 | + | |
| 863 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1336 | |
| 864 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1427 | |
| 865 | +msgid "Provide the unique ID of the target scene." | |
| 342 | 866 | msgstr "" |
| 343 | 867 | |
| 344 | -#: admin/partials/wpvr_setup_wizard.php:75 | |
| 345 | -msgid "Cubemap Images" | |
| 346 | -msgstr "" | |
| 868 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1456 | |
| 869 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1522 | |
| 870 | +msgid "Select your form" | |
| 871 | +msgstr "Wybierz swój formularz" | |
| 347 | 872 | |
| 348 | -#: admin/partials/wpvr_setup_wizard.php:155 | |
| 873 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1646 | |
| 874 | +msgid "Basic Settings" | |
| 875 | +msgstr "Podstawowe ustawienia" | |
| 876 | + | |
| 877 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1655 | |
| 878 | +msgid "Advanced Controls" | |
| 879 | +msgstr "Zaawansowane sterowanie" | |
| 880 | + | |
| 881 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1700 | |
| 882 | +msgid "Documentation " | |
| 883 | +msgstr "dokumentacja" | |
| 884 | + | |
| 885 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1918 | |
| 349 | 886 | #, fuzzy |
| 350 | -#| msgid "Custom control buttons" | |
| 351 | -msgid "Custom Control Buttons" | |
| 352 | -msgstr "Niestandardowe przyciski sterujące" | |
| 887 | +msgid "Video Tour" | |
| 888 | +msgstr "wycieczka z przewodnikiem" | |
| 353 | 889 | |
| 354 | -#: admin/classes/class-wpvr-meta-field.php:478 | |
| 355 | -msgid "Custom CSS" | |
| 890 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1938 | |
| 891 | +msgid "Enable or disable video mode using self-hosted, YouTube, or Vimeo." | |
| 356 | 892 | msgstr "" |
| 357 | 893 | |
| 358 | -#: admin/classes/class-wpvr-meta-field.php:305 | |
| 359 | -msgid "Custom CSS " | |
| 894 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1945 | |
| 895 | +msgid "Upload or Add Link" | |
| 896 | +msgstr "Prześlij lub dodaj link" | |
| 897 | + | |
| 898 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1946 | |
| 899 | +msgid "Paste Youtube or Vimeo link or upload" | |
| 900 | +msgstr "Wklej link do YouTube lub Vimeo lub prześlij" | |
| 901 | + | |
| 902 | +#: legacy/admin/classes/class-wpvr-meta-field.php:1952 | |
| 903 | +msgid "Use a self-hosted file or paste a YouTube/Vimeo link." | |
| 360 | 904 | msgstr "" |
| 361 | 905 | |
| 362 | -#: admin/partials/wpvr_documentation.php:430 | |
| 363 | -msgid "Custom Icon & Color for Hotspots (Using CSS)" | |
| 906 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2010 | |
| 907 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2062 | |
| 908 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2116 | |
| 909 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2158 | |
| 910 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2207 | |
| 911 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2282 | |
| 912 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2338 | |
| 913 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2397 | |
| 914 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2457 | |
| 915 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2514 | |
| 916 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2571 | |
| 917 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2628 | |
| 918 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2704 | |
| 919 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2856 | |
| 920 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2999 | |
| 921 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3065 | |
| 922 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3119 | |
| 923 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3180 | |
| 924 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3230 | |
| 925 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3284 | |
| 926 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3332 | |
| 927 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3418 | |
| 928 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3470 | |
| 929 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3524 | |
| 930 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3580 | |
| 931 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3630 | |
| 932 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3678 | |
| 933 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3767 | |
| 934 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3819 | |
| 935 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3870 | |
| 936 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3973 | |
| 937 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4025 | |
| 938 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4077 | |
| 939 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4123 | |
| 940 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4181 | |
| 941 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4225 | |
| 942 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4270 | |
| 943 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4315 | |
| 944 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4426 | |
| 945 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4474 | |
| 946 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4571 | |
| 947 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4644 | |
| 948 | +#: legacy/admin/classes/class-wpvr-meta-field.php:5005 | |
| 949 | +#: legacy/admin/classes/class-wpvr-meta-field.php:5057 | |
| 950 | +#: legacy/admin/classes/class-wpvr-meta-field.php:5157 | |
| 951 | +#: legacy/admin/classes/class-wpvr-meta-field.php:5257 | |
| 952 | +#: legacy/admin/classes/class-wpvr-meta-field.php:5374 | |
| 953 | +#: legacy/admin/classes/class-wpvr-meta-field.php:5487 | |
| 954 | +#: legacy/admin/classes/class-wpvr-meta-field.php:5593 | |
| 955 | +#: legacy/admin/classes/class-wpvr-meta-field.php:5705 | |
| 956 | +#: legacy/admin/classes/class-wpvr-meta-field.php:5812 | |
| 957 | +#: legacy/includes/class-wpvr.php:356 | |
| 958 | +msgid "View Doc" | |
| 364 | 959 | msgstr "" |
| 365 | 960 | |
| 366 | -#: admin/classes/class-wpvr-meta-field.php:2771 | |
| 961 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2021 | |
| 962 | +#: legacy/admin/partials/wpvr-review-request-body-content.php:6 | |
| 963 | +#: legacy/admin/partials/wpvr_confirmation_alert.php:30 | |
| 964 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:173 | |
| 965 | +msgid "Yes" | |
| 966 | +msgstr "ba" | |
| 967 | + | |
| 968 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2022 | |
| 969 | +#: legacy/admin/partials/wpvr_confirmation_alert.php:27 | |
| 970 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:174 | |
| 971 | +msgid "No" | |
| 972 | +msgstr "bynajm" | |
| 973 | + | |
| 974 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2073 | |
| 975 | +msgid "Equirectangular" | |
| 976 | +msgstr "równowartościowy" | |
| 977 | + | |
| 978 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2074 | |
| 979 | +msgid "Cubemap" | |
| 980 | +msgstr "Mapa słowna" | |
| 981 | + | |
| 982 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2270 | |
| 983 | +#, fuzzy | |
| 984 | +msgid "Scene Upload:" | |
| 985 | +msgstr "Przesyłanie sceny:" | |
| 986 | + | |
| 987 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2772 | |
| 988 | +#, fuzzy | |
| 989 | +msgid "Upload" | |
| 990 | +msgstr "Przesyłanie sceny" | |
| 991 | + | |
| 992 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2797 | |
| 367 | 993 | msgid "" |
| 368 | -"Custom icons will only show on frontend. Hotspot custom icons only works " | |
| 369 | -"with fontawesome 5. If you are using any different version of fontawesome " | |
| 370 | -"under theme or any plugin, you may deactivate fontawesome from WP VR. Go to " | |
| 371 | -"\"Get Started menu\" and select \"Role\" and check fontawesome disable " | |
| 372 | -"switch. Now put your desired any icon class under \"Hotspot custom icon " | |
| 373 | -"class\" field. It will appear on the frontend." | |
| 994 | +"You can add any logo size. But recommended size is below 100x100 px for " | |
| 995 | +"perfect look." | |
| 374 | 996 | msgstr "" |
| 375 | 997 | |
| 376 | -#: admin/partials/wpvr_documentation.php:663 | |
| 377 | -msgid "Custom Panorama Loading Face" | |
| 998 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2816 | |
| 999 | +msgid "Company Details : " | |
| 378 | 1000 | msgstr "" |
| 379 | 1001 | |
| 380 | -#: admin/partials/wpvr_documentation.php:579 | |
| 381 | -msgid "Custom Preview Image & Text" | |
| 1002 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2939 | |
| 1003 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4707 | |
| 1004 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4717 | |
| 1005 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4819 | |
| 1006 | +msgid "Color" | |
| 1007 | +msgstr "zafarb" | |
| 1008 | + | |
| 1009 | +#: legacy/admin/classes/class-wpvr-meta-field.php:2946 | |
| 1010 | +msgid "Icon" | |
| 382 | 1011 | msgstr "" |
| 383 | 1012 | |
| 384 | -#: admin/partials/wpvr_documentation.php:553 | |
| 385 | -msgid "Custom Rotation Settings" | |
| 1013 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3018 | |
| 1014 | +#, fuzzy | |
| 1015 | +msgid "Upload icon" | |
| 1016 | +msgstr "Prześlij lub dodaj link" | |
| 1017 | + | |
| 1018 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3020 | |
| 1019 | +msgid "Click to" | |
| 386 | 1020 | msgstr "" |
| 387 | 1021 | |
| 388 | -#: admin/partials/wpvr_documentation.php:649 | |
| 389 | -msgid "Custom Zoom Settings" | |
| 1022 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3020 | |
| 1023 | +#, fuzzy | |
| 1024 | +msgid "Upload an Image" | |
| 1025 | +msgstr "Prześlij obraz panoramy" | |
| 1026 | + | |
| 1027 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3025 | |
| 1028 | +msgid "This option will not work if the \"Tour Autoload\" is turned on." | |
| 1029 | +msgstr "Ta opcja nie zadziała, jeśli włączono „Tour Autoload”." | |
| 1030 | + | |
| 1031 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3354 | |
| 1032 | +msgid "Classic Layout" | |
| 390 | 1033 | msgstr "" |
| 391 | 1034 | |
| 392 | -#: admin/partials/wpvr_documentation.php:738 | |
| 393 | -msgid "Customize Icon & Logo of Control Buttons." | |
| 1035 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3367 | |
| 1036 | +msgid "Modern Layout" | |
| 394 | 1037 | msgstr "" |
| 395 | 1038 | |
| 396 | -#: admin/partials/wpvr_license.php:34 | |
| 397 | -msgid "Deactivate License" | |
| 398 | -msgstr "Dezaktywuj licencję" | |
| 1039 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3659 | |
| 1040 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3712 | |
| 1041 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4455 | |
| 1042 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4516 | |
| 1043 | +msgid "Info" | |
| 1044 | +msgstr "info" | |
| 399 | 1045 | |
| 400 | -#: admin/partials/wpvr_setup_wizard.php:125 | |
| 401 | -msgid "Decisions" | |
| 1046 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3660 | |
| 1047 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3713 | |
| 1048 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4456 | |
| 1049 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4517 | |
| 1050 | +#, fuzzy | |
| 1051 | +msgid "Scene" | |
| 1052 | +msgstr "scenki" | |
| 1053 | + | |
| 1054 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3671 | |
| 1055 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4467 | |
| 1056 | +msgid "" | |
| 1057 | +"Choose the type of hotspot: Info (displays information) or Scene (links to " | |
| 1058 | +"another scene)." | |
| 402 | 1059 | msgstr "" |
| 403 | 1060 | |
| 404 | -#: admin/partials/wpvr_documentation.php:857 | |
| 405 | -msgid "Disable Fontawesome from WP VR:" | |
| 1061 | +#: legacy/admin/classes/class-wpvr-meta-field.php:3860 | |
| 1062 | +msgid "Tooltip Icon" | |
| 406 | 1063 | msgstr "" |
| 407 | 1064 | |
| 408 | -#: admin/classes/class-wpvr-meta-field.php:252 | |
| 409 | -msgid "Disable keyboard control to use the form." | |
| 1065 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4116 | |
| 1066 | +msgid "Select a custom icon for the hotspot." | |
| 410 | 1067 | msgstr "" |
| 411 | 1068 | |
| 412 | -#: admin/partials/wpvr_documentation.php:935 | |
| 413 | -msgid "Disable On Hover Content for Mobile:" | |
| 1069 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4174 | |
| 1070 | +msgid "Set a custom background color for the hotspot." | |
| 414 | 1071 | msgstr "" |
| 415 | 1072 | |
| 416 | -#: admin/partials/wpvr_documentation.php:909 | |
| 417 | -msgid "Disable WordPress Large Image Handler on WP VR:" | |
| 1073 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4218 | |
| 1074 | +msgid "Set a custom color for the hotspot icon." | |
| 418 | 1075 | msgstr "" |
| 419 | 1076 | |
| 420 | -#: admin/partials/wpvr_documentation.php:766 | |
| 1077 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4263 | |
| 1078 | +msgid "Enable an animation for the hotspot." | |
| 1079 | +msgstr "" | |
| 1080 | + | |
| 1081 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4308 | |
| 421 | 1082 | msgid "" |
| 422 | -"Do not close or refresh the page during import process. It may take few " | |
| 423 | -"minutes." | |
| 1083 | +"Add a border around the hotspot with customizable color, style, and " | |
| 1084 | +"thickness." | |
| 424 | 1085 | msgstr "" |
| 425 | -"Nie zamykaj ani nie odświeżaj strony podczas procesu importowania. Może to " | |
| 426 | -"potrwać kilka minut." | |
| 427 | 1086 | |
| 428 | -#: admin/class-wpvr-admin.php:282 admin/partials/wpvr_documentation.php:202 | |
| 429 | -#: admin/partials/wpvr_documentation.php:204 | |
| 430 | -msgid "Documentation" | |
| 431 | -msgstr "Dokumentacja" | |
| 1087 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4419 | |
| 1088 | +msgid "Select the shape of the hotspot (e.g., Rounded, square, and Hexagon)." | |
| 1089 | +msgstr "" | |
| 432 | 1090 | |
| 433 | -#: admin/classes/class-wpvr-meta-field.php:1365 | |
| 434 | -msgid "Documentation " | |
| 1091 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4698 | |
| 1092 | +msgid "Open in new tab" | |
| 1093 | +msgstr "Otwórz w nowej karcie" | |
| 1094 | + | |
| 1095 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4705 | |
| 1096 | +#, fuzzy | |
| 1097 | +msgid "Background Color :" | |
| 1098 | +msgstr "Kolor tła" | |
| 1099 | + | |
| 1100 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4714 | |
| 1101 | +#, fuzzy | |
| 1102 | +msgid "Font color :" | |
| 1103 | +msgstr "kolor czcionki" | |
| 1104 | + | |
| 1105 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4724 | |
| 1106 | +#, fuzzy | |
| 1107 | +msgid "Font Size (px) :" | |
| 1108 | +msgstr "Rozmiar czcionki (PX)" | |
| 1109 | + | |
| 1110 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4729 | |
| 1111 | +#, fuzzy | |
| 1112 | +msgid "Font Weight :" | |
| 1113 | +msgstr "Waga czcion" | |
| 1114 | + | |
| 1115 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4741 | |
| 1116 | +#, fuzzy | |
| 1117 | +msgid "Line Height :" | |
| 1118 | +msgstr "Wysokość linii" | |
| 1119 | + | |
| 1120 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4746 | |
| 1121 | +#, fuzzy | |
| 1122 | +msgid "Text Decoration :" | |
| 1123 | +msgstr "Dekoracja tekstu" | |
| 1124 | + | |
| 1125 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4748 | |
| 1126 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4758 | |
| 1127 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4933 | |
| 1128 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:41 legacy/src/index.js:41 | |
| 1129 | +#: legacy/src/index.js:72 | |
| 1130 | +msgid "None" | |
| 1131 | +msgstr "żaden" | |
| 1132 | + | |
| 1133 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4749 | |
| 1134 | +msgid "Underline" | |
| 1135 | +msgstr "uwydatniać" | |
| 1136 | + | |
| 1137 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4750 | |
| 1138 | +msgid "Overline" | |
| 1139 | +msgstr "wyciąć" | |
| 1140 | + | |
| 1141 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4751 | |
| 1142 | +msgid "Line Through" | |
| 1143 | +msgstr "przejechać" | |
| 1144 | + | |
| 1145 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4756 | |
| 1146 | +#, fuzzy | |
| 1147 | +msgid "Text Transform :" | |
| 1148 | +msgstr "Przekształć tekst" | |
| 1149 | + | |
| 1150 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4759 | |
| 1151 | +msgid "Uppercase" | |
| 1152 | +msgstr "wielkie litery" | |
| 1153 | + | |
| 1154 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4760 | |
| 1155 | +msgid "Lowercase" | |
| 1156 | +msgstr "małe litery" | |
| 1157 | + | |
| 1158 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4761 | |
| 1159 | +msgid "Capitalize" | |
| 1160 | +msgstr "spieniężać" | |
| 1161 | + | |
| 1162 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4766 | |
| 1163 | +#, fuzzy | |
| 1164 | +msgid "Button Alignment :" | |
| 1165 | +msgstr "Wyrównanie przycisków" | |
| 1166 | + | |
| 1167 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4768 | |
| 1168 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4846 | |
| 1169 | +msgid "Left" | |
| 1170 | +msgstr "lewo" | |
| 1171 | + | |
| 1172 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4769 | |
| 1173 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4836 | |
| 1174 | +msgid "Right" | |
| 1175 | +msgstr "w porządku" | |
| 1176 | + | |
| 1177 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4770 | |
| 1178 | +msgid "Center" | |
| 1179 | +msgstr "skupisko" | |
| 1180 | + | |
| 1181 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4771 | |
| 1182 | +msgid "Justified" | |
| 1183 | +msgstr "usprawiedliwiony" | |
| 1184 | + | |
| 1185 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4776 | |
| 1186 | +#, fuzzy | |
| 1187 | +msgid "Font Style :" | |
| 1188 | +msgstr "Styl czcionki" | |
| 1189 | + | |
| 1190 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4778 | |
| 1191 | +msgid "Normal" | |
| 1192 | +msgstr "normalny" | |
| 1193 | + | |
| 1194 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4779 | |
| 1195 | +msgid "Italic" | |
| 1196 | +msgstr "italski" | |
| 1197 | + | |
| 1198 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4780 | |
| 1199 | +msgid "Oblique" | |
| 1200 | +msgstr "skośny" | |
| 1201 | + | |
| 1202 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4785 | |
| 1203 | +#, fuzzy | |
| 1204 | +msgid "Letter Spacing (px) :" | |
| 1205 | +msgstr "Rozstaw liter (PX)" | |
| 1206 | + | |
| 1207 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4790 | |
| 1208 | +#, fuzzy | |
| 1209 | +msgid "Word Spacing (px) :" | |
| 1210 | +msgstr "Odstępy słów (PX)" | |
| 1211 | + | |
| 1212 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4795 | |
| 1213 | +#, fuzzy | |
| 1214 | +msgid "Border Radius (px) :" | |
| 1215 | +msgstr "Promień granicy (PX)" | |
| 1216 | + | |
| 1217 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4800 | |
| 1218 | +#, fuzzy | |
| 1219 | +msgid "Border :" | |
| 1220 | +msgstr "okalać" | |
| 1221 | + | |
| 1222 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4803 | |
| 1223 | +msgid "Width (px)" | |
| 1224 | +msgstr "Szerokość (Px)" | |
| 1225 | + | |
| 1226 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4808 | |
| 1227 | +msgid "Style" | |
| 1228 | +msgstr "wskazówka zegar" | |
| 1229 | + | |
| 1230 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4828 | |
| 1231 | +#, fuzzy | |
| 1232 | +msgid "Padding (px) :" | |
| 1233 | +msgstr "Wyściółka (PX)" | |
| 1234 | + | |
| 1235 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4831 | |
| 1236 | +msgid "Top" | |
| 1237 | +msgstr "buda woz" | |
| 1238 | + | |
| 1239 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4841 | |
| 1240 | +msgid "Bottom" | |
| 1241 | +msgstr "spód" | |
| 1242 | + | |
| 1243 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4934 | |
| 1244 | +msgid "Circle Crop" | |
| 435 | 1245 | msgstr "" |
| 436 | 1246 | |
| 437 | -#: admin/partials/wpvr_documentation.php:621 | |
| 438 | -msgid "Duplicate Tours with One Click" | |
| 1247 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4936 | |
| 1248 | +msgid "Zoom In" | |
| 1249 | +msgstr "pomakżyć" | |
| 1250 | + | |
| 1251 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4937 | |
| 1252 | +#, fuzzy | |
| 1253 | +msgid "Zoom In Up" | |
| 1254 | +msgstr "pomakżyć" | |
| 1255 | + | |
| 1256 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4938 | |
| 1257 | +#, fuzzy | |
| 1258 | +msgid "Zoom In Down" | |
| 1259 | +msgstr "pomakżyć" | |
| 1260 | + | |
| 1261 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4939 | |
| 1262 | +#, fuzzy | |
| 1263 | +msgid "Zoom In Left" | |
| 1264 | +msgstr "pomakżyć" | |
| 1265 | + | |
| 1266 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4940 | |
| 1267 | +#, fuzzy | |
| 1268 | +msgid "Zoom In Right" | |
| 1269 | +msgstr "pomakżyć" | |
| 1270 | + | |
| 1271 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4942 | |
| 1272 | +msgid "Slide In Up" | |
| 439 | 1273 | msgstr "" |
| 440 | 1274 | |
| 441 | -#: admin/partials/wpvr_documentation.php:826 | |
| 442 | -msgid "" | |
| 443 | -"Editors will be able to Create, Edit, Update, and Delete all virtual tours." | |
| 1275 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4943 | |
| 1276 | +msgid "Slide In Down" | |
| 444 | 1277 | msgstr "" |
| 445 | 1278 | |
| 446 | -#: admin/classes/class-wpvr-meta-field.php:741 | |
| 447 | -msgid "Enable explainer video" | |
| 1279 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4944 | |
| 1280 | +msgid "Slide In Left" | |
| 448 | 1281 | msgstr "" |
| 449 | 1282 | |
| 450 | -#: admin/partials/wpvr_documentation.php:883 | |
| 451 | -msgid "Enable mobile media resizer:" | |
| 1283 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4945 | |
| 1284 | +msgid "Slide In Right" | |
| 452 | 1285 | msgstr "" |
| 453 | 1286 | |
| 454 | -#: admin/partials/wpvr_documentation.php:710 | |
| 455 | -msgid "Enable or Disable Keyboard Movement Control." | |
| 1287 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4947 | |
| 1288 | +msgid "Fade With Blur" | |
| 456 | 1289 | msgstr "" |
| 457 | 1290 | |
| 458 | -#: admin/partials/wpvr_documentation.php:714 | |
| 459 | -msgid "Enable or Disable Keyboard Zoom Control." | |
| 1291 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4948 | |
| 1292 | +msgid "Fade In" | |
| 460 | 1293 | msgstr "" |
| 461 | 1294 | |
| 462 | -#: admin/partials/wpvr_documentation.php:718 | |
| 463 | -msgid "Enable or Disable Mouse Drag Control." | |
| 1295 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4949 | |
| 1296 | +msgid "Fade In Up" | |
| 464 | 1297 | msgstr "" |
| 465 | 1298 | |
| 466 | -#: admin/partials/wpvr_documentation.php:722 | |
| 467 | -msgid "Enable or Disable Mouse Zoom control." | |
| 1299 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4950 | |
| 1300 | +msgid "Fade In Down" | |
| 468 | 1301 | msgstr "" |
| 469 | 1302 | |
| 470 | -#: admin/partials/wpvr_documentation.php:962 | |
| 471 | -msgid "" | |
| 472 | -"Enable script control (It will load the WP VR scripts on the pages with " | |
| 473 | -"virtual tours only):" | |
| 1303 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4951 | |
| 1304 | +msgid "Fade In Left" | |
| 474 | 1305 | msgstr "" |
| 475 | 1306 | |
| 476 | -#: admin/classes/class-wpvr-general.php:121 | |
| 477 | -msgid "Enable Social Media Share" | |
| 1307 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4952 | |
| 1308 | +#, fuzzy | |
| 1309 | +msgid "Fade In Right" | |
| 1310 | +msgstr "Ruszaj w prawo" | |
| 1311 | + | |
| 1312 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4953 | |
| 1313 | +msgid "Fade In Top Left" | |
| 478 | 1314 | msgstr "" |
| 479 | 1315 | |
| 480 | -#: admin/classes/class-wpvr-meta-field.php:281 | |
| 481 | -msgid "Enable the call to action, it will render under the tour." | |
| 1316 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4954 | |
| 1317 | +msgid "Fade In Top Right" | |
| 482 | 1318 | msgstr "" |
| 483 | 1319 | |
| 484 | -#: admin/classes/class-wpvr-meta-field.php:1583 | |
| 485 | -msgid "Enable Video" | |
| 1320 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4955 | |
| 1321 | +msgid "Fade In Bottom Left" | |
| 486 | 1322 | msgstr "" |
| 487 | 1323 | |
| 488 | -#: admin/partials/wpvr_documentation.php:1002 | |
| 489 | -msgid "" | |
| 490 | -"Enable Video JS control (It will load the WP VR Video JS library in the " | |
| 491 | -"listed pages only):" | |
| 1324 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4956 | |
| 1325 | +msgid "Fade In Bottom Right" | |
| 492 | 1326 | msgstr "" |
| 493 | 1327 | |
| 494 | -#: admin/classes/class-tour-guide-translation.php:10 | |
| 495 | -msgid "End Tour" | |
| 1328 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4958 | |
| 1329 | +msgid "Back In Left" | |
| 496 | 1330 | msgstr "" |
| 497 | 1331 | |
| 498 | -#: admin/partials/wpvr_license.php:22 | |
| 499 | -msgid "Enter your license key, save changes and activate." | |
| 500 | -msgstr "Wprowadź swój klucz licencyjny, zapisz zmiany i aktywuj." | |
| 1332 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4959 | |
| 1333 | +msgid "Back In Right" | |
| 1334 | +msgstr "" | |
| 501 | 1335 | |
| 502 | -#: admin/classes/class-wpvr-meta-field.php:1676 | |
| 503 | -msgid "Equirectangular" | |
| 1336 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4960 | |
| 1337 | +msgid "Back In Up" | |
| 504 | 1338 | msgstr "" |
| 505 | 1339 | |
| 506 | -#: admin/classes/class-wpvr-meta-field.php:845 | |
| 507 | -msgid "Explainer" | |
| 1340 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4961 | |
| 1341 | +msgid "Back In Down" | |
| 508 | 1342 | msgstr "" |
| 509 | 1343 | |
| 510 | -#: admin/partials/wpvr_documentation.php:374 | |
| 511 | -#: admin/partials/wpvr_setup_wizard.php:176 | |
| 512 | -msgid "Explainer Video" | |
| 1344 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4963 | |
| 1345 | +msgid "Bounce In" | |
| 513 | 1346 | msgstr "" |
| 514 | 1347 | |
| 515 | -#: admin/partials/wpvr_documentation.php:285 | |
| 516 | -msgid "features" | |
| 1348 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4964 | |
| 1349 | +msgid "Bounce In Up" | |
| 517 | 1350 | msgstr "" |
| 518 | 1351 | |
| 519 | -#: admin/partials/wpvr_setup_wizard.php:125 | |
| 520 | -msgid "Features That Can" | |
| 1352 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4965 | |
| 1353 | +#, fuzzy | |
| 1354 | +msgid "Bounce In Down" | |
| 1355 | +msgstr "opuszczać" | |
| 1356 | + | |
| 1357 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4966 | |
| 1358 | +#, fuzzy | |
| 1359 | +msgid "Bounce In Left" | |
| 1360 | +msgstr "Przesuń się w lewo" | |
| 1361 | + | |
| 1362 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4967 | |
| 1363 | +#, fuzzy | |
| 1364 | +msgid "Bounce In Right" | |
| 1365 | +msgstr "Ruszaj w prawo" | |
| 1366 | + | |
| 1367 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4969 | |
| 1368 | +msgid "Flip" | |
| 521 | 1369 | msgstr "" |
| 522 | 1370 | |
| 523 | -#: admin/partials/wpvr_documentation.php:1048 | |
| 524 | -msgid "Flip the phone to landscape mode for a better experience of the tour." | |
| 1371 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4970 | |
| 1372 | +msgid "Flip X" | |
| 525 | 1373 | msgstr "" |
| 526 | 1374 | |
| 527 | -#: admin/partials/wpvr_documentation.php:526 | |
| 528 | -msgid "Fluent Forms Add-on" | |
| 1375 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4971 | |
| 1376 | +msgid "Flip Y" | |
| 529 | 1377 | msgstr "" |
| 530 | 1378 | |
| 531 | -#: admin/partials/wpvr_setup_wizard.php:11 | |
| 532 | -msgid "Follow the Guided Wizard and Learn How it Works." | |
| 1379 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4973 | |
| 1380 | +msgid "Light Speed In Left" | |
| 533 | 1381 | msgstr "" |
| 534 | 1382 | |
| 535 | -#: admin/classes/class-wpvr-meta-field.php:3037 | |
| 536 | -msgid "Font color" | |
| 1383 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4974 | |
| 1384 | +msgid "Light Speed In Right" | |
| 537 | 1385 | msgstr "" |
| 538 | 1386 | |
| 539 | -#: admin/classes/class-wpvr-meta-field.php:3042 | |
| 540 | -msgid "Font Size (px)" | |
| 1387 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4976 | |
| 1388 | +msgid "Rotate In" | |
| 541 | 1389 | msgstr "" |
| 542 | 1390 | |
| 543 | -#: admin/classes/class-wpvr-meta-field.php:3094 | |
| 544 | -msgid "Font Style" | |
| 1391 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4977 | |
| 1392 | +msgid "Rotate In Up Left" | |
| 545 | 1393 | msgstr "" |
| 546 | 1394 | |
| 547 | -#: admin/classes/class-wpvr-meta-field.php:3047 | |
| 548 | -msgid "Font Weight" | |
| 1395 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4978 | |
| 1396 | +msgid "Rotate In Up Right" | |
| 549 | 1397 | msgstr "" |
| 550 | 1398 | |
| 551 | -#: admin/partials/wpvr_setup_wizard.php:10 | |
| 552 | -msgid "for Choosing" | |
| 1399 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4979 | |
| 1400 | +msgid "Rotate In Down Left" | |
| 553 | 1401 | msgstr "" |
| 554 | 1402 | |
| 555 | -#: admin/classes/class-wpvr-shortcode.php:36 | |
| 556 | -#, fuzzy | |
| 557 | -#| msgid "For classic editor:" | |
| 558 | -msgid "For Classic Editor:" | |
| 559 | -msgstr "W przypadku klasycznego edytora:" | |
| 1403 | +#: legacy/admin/classes/class-wpvr-meta-field.php:4980 | |
| 1404 | +msgid "Rotate In Down Right" | |
| 1405 | +msgstr "" | |
| 560 | 1406 | |
| 561 | -#: admin/partials/wpvr_setup_wizard.php:194 | |
| 562 | -msgid "for unlimited virtual tours." | |
| 1407 | +#: legacy/admin/classes/class-wpvr-meta-field.php:5034 | |
| 1408 | +msgid "All Membership Levels" | |
| 563 | 1409 | msgstr "" |
| 564 | 1410 | |
| 565 | -#: admin/partials/wpvr_setup_wizard.php:43 | |
| 566 | -msgid "for Virtual Tours, Viewing Panoramas, and 360 Degree Content" | |
| 1411 | +#: legacy/admin/classes/class-wpvr-meta-field.php:5789 | |
| 1412 | +msgid "Large" | |
| 567 | 1413 | msgstr "" |
| 568 | 1414 | |
| 569 | -#: admin/partials/wpvr_documentation.php:286 | |
| 570 | -msgid "free" | |
| 1415 | +#: legacy/admin/classes/class-wpvr-meta-field.php:5790 | |
| 1416 | +msgid "Small" | |
| 571 | 1417 | msgstr "" |
| 572 | 1418 | |
| 573 | -#: admin/partials/wpvr_documentation.php:121 | |
| 574 | -msgid "Free vs Pro" | |
| 1419 | +#: legacy/admin/classes/class-wpvr-occasion-banner.php:120 | |
| 1420 | +msgid "4th of july special offer logo" | |
| 575 | 1421 | msgstr "" |
| 576 | 1422 | |
| 577 | -#: admin/partials/wpvr_documentation.php:1051 | |
| 578 | -msgid "Front-End Notice for Mobile Visitors:" | |
| 1423 | +#: legacy/admin/classes/class-wpvr-occasion-banner.php:124 | |
| 1424 | +msgid "Biggest sale of the year!" | |
| 579 | 1425 | msgstr "" |
| 580 | 1426 | |
| 581 | -#: admin/partials/wpvr_documentation.php:566 | |
| 582 | -msgid "Full Page Virtual Tours" | |
| 1427 | +#: legacy/admin/classes/class-wpvr-occasion-banner.php:128 | |
| 1428 | +msgid "4th of july special discount" | |
| 583 | 1429 | msgstr "" |
| 584 | 1430 | |
| 585 | -#: admin/classes/class-wpvr-meta-field.php:826 | |
| 586 | -msgid "Full Screen" | |
| 1431 | +#: legacy/admin/classes/class-wpvr-occasion-banner.php:133 | |
| 1432 | +msgid "Offer Countdown" | |
| 587 | 1433 | msgstr "" |
| 588 | 1434 | |
| 589 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:132 | |
| 590 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:133 | |
| 591 | -msgid "Fullwidth" | |
| 1435 | +#: legacy/admin/classes/class-wpvr-occasion-banner.php:152 | |
| 1436 | +msgid "Click to view 4th of july sale products" | |
| 592 | 1437 | msgstr "" |
| 593 | 1438 | |
| 594 | -#: admin/classes/class-wpvr-meta-field.php:106 | |
| 595 | -msgid "General" | |
| 596 | -msgstr "Generał" | |
| 1439 | +#: legacy/admin/classes/class-wpvr-occasion-banner.php:154 | |
| 1440 | +msgid "Get The Deal" | |
| 1441 | +msgstr "" | |
| 597 | 1442 | |
| 598 | -#: admin/partials/wpvr_documentation.php:784 | |
| 599 | -msgid "General Setup Options" | |
| 1443 | +#: legacy/admin/classes/class-wpvr-onboarding-notice.php:288 | |
| 1444 | +msgid "" | |
| 1445 | +"You haven't created a virtual tour yet. Our quick setup wizard will help you " | |
| 1446 | +"publish your first tour in minutes!" | |
| 600 | 1447 | msgstr "" |
| 601 | 1448 | |
| 602 | -#: admin/classes/class-wpvr-meta-field.php:247 | |
| 603 | -msgid "Generic Form" | |
| 1449 | +#: legacy/admin/classes/class-wpvr-onboarding-notice.php:293 | |
| 1450 | +msgid "Start setup wizard" | |
| 604 | 1451 | msgstr "" |
| 605 | 1452 | |
| 606 | -#: admin/partials/wpvr_setup_wizard.php:193 | |
| 607 | -msgid "Get Access to " | |
| 1453 | +#: legacy/admin/classes/class-wpvr-onboarding-notice.php:300 | |
| 1454 | +#: src/Admin/UiModeSwitcher.php:134 | |
| 1455 | +msgid "Dismiss this notice" | |
| 608 | 1456 | msgstr "" |
| 609 | 1457 | |
| 610 | -#: admin/partials/wpvr_documentation.php:236 | |
| 611 | -#: admin/partials/wpvr_documentation.php:246 | |
| 612 | -msgid "Get It Now" | |
| 1458 | +#: legacy/admin/classes/class-wpvr-onboarding-notice.php:301 | |
| 1459 | +msgid "Dismiss" | |
| 613 | 1460 | msgstr "" |
| 614 | 1461 | |
| 615 | -#: admin/partials/wpvr_setup_wizard.php:197 | |
| 616 | -msgid "Get Pro Now" | |
| 1462 | +#: legacy/admin/classes/class-wpvr-post-type.php:98 | |
| 1463 | +#: legacy/admin/classes/class-wpvr-post-type.php:184 | |
| 1464 | +msgid "Create Tour" | |
| 617 | 1465 | msgstr "" |
| 618 | 1466 | |
| 619 | -#: admin/class-wpvr-admin.php:277 admin/classes/class-wpvr-admin-pages.php:68 | |
| 620 | -#: admin/classes/class-wpvr-admin-pages.php:76 | |
| 621 | -msgid "Get Started" | |
| 1467 | +#: legacy/admin/classes/class-wpvr-post-type.php:107 | |
| 1468 | +#, fuzzy | |
| 1469 | +msgid "Select your preferred tour" | |
| 1470 | +msgstr "Wybierz swój formularz" | |
| 1471 | + | |
| 1472 | +#: legacy/admin/classes/class-wpvr-post-type.php:117 | |
| 1473 | +msgid "360 Image Tour" | |
| 622 | 1474 | msgstr "" |
| 623 | 1475 | |
| 624 | -#: admin/classes/class-tour-guide-translation.php:13 | |
| 625 | -msgid "Give a name to your virtual tour." | |
| 1476 | +#: legacy/admin/classes/class-wpvr-post-type.php:128 | |
| 1477 | +#, fuzzy | |
| 1478 | +msgid "360 Video Tour" | |
| 1479 | +msgstr "Wsparcie wideo 360" | |
| 1480 | + | |
| 1481 | +#: legacy/admin/classes/class-wpvr-post-type.php:174 src/Admin/Admin.php:497 | |
| 1482 | +msgid "Tour Name" | |
| 626 | 1483 | msgstr "" |
| 627 | 1484 | |
| 628 | -#: admin/class-wpvr-admin.php:289 admin/classes/class-wpvr-admin-pages.php:84 | |
| 629 | -msgid "Go Pro" | |
| 1485 | +#: legacy/admin/classes/class-wpvr-post-type.php:182 | |
| 1486 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:198 | |
| 1487 | +#: src/Admin/Admin.php:568 app/components/modals/CreateSceneModal.jsx:638 | |
| 1488 | +msgid "Cancel" | |
| 630 | 1489 | msgstr "" |
| 631 | 1490 | |
| 632 | -#: admin/partials/wpvr_documentation.php:486 | |
| 633 | -#: admin/partials/wpvr_setup_wizard.php:99 | |
| 634 | -msgid "Google Street View" | |
| 1491 | +#: legacy/admin/classes/class-wpvr-post-type.php:367 src/Admin/Admin.php:57 | |
| 1492 | +#: src/Admin/Admin.php:234 src/Admin/Admin.php:357 | |
| 1493 | +#, fuzzy | |
| 1494 | +msgid "Edit Tour" | |
| 1495 | +msgstr "koniec wycieczki" | |
| 1496 | + | |
| 1497 | +#: legacy/admin/classes/class-wpvr-post-type.php:368 | |
| 1498 | +#: src/Api/Services/TourService.php:244 | |
| 1499 | +#, fuzzy | |
| 1500 | +msgid "New Tour" | |
| 1501 | +msgstr "Dodaj nową wycieczkę" | |
| 1502 | + | |
| 1503 | +#: legacy/admin/classes/class-wpvr-post-type.php:369 | |
| 1504 | +#, fuzzy | |
| 1505 | +msgid "View Tour" | |
| 1506 | +msgstr "wycieczka z przewodnikiem" | |
| 1507 | + | |
| 1508 | +#: legacy/admin/classes/class-wpvr-post-type.php:370 | |
| 1509 | +#, fuzzy | |
| 1510 | +msgid "Search WP VR Tour" | |
| 1511 | +msgstr "Identyfikator trasy WPVR" | |
| 1512 | + | |
| 1513 | +#: legacy/admin/classes/class-wpvr-post-type.php:371 | |
| 1514 | +#, fuzzy | |
| 1515 | +msgid "No WP VR Tour found" | |
| 1516 | +msgstr "Identyfikator trasy WPVR" | |
| 1517 | + | |
| 1518 | +#: legacy/admin/classes/class-wpvr-post-type.php:372 | |
| 1519 | +msgid "No WP VR Tour found in Trash" | |
| 635 | 1520 | msgstr "" |
| 636 | 1521 | |
| 637 | -#: admin/classes/class-wpvr-admin-pages.php:75 | |
| 638 | -msgid "Guided Tour" | |
| 1522 | +#: legacy/admin/classes/class-wpvr-post-type.php:374 | |
| 1523 | +#, fuzzy | |
| 1524 | +msgid "All Tours" | |
| 1525 | +msgstr "wycieczki" | |
| 1526 | + | |
| 1527 | +#: legacy/admin/classes/class-wpvr-post-type.php:375 | |
| 1528 | +#: legacy/oxygen/WPVR_OXY_INTEGRATION.php:38 | |
| 1529 | +msgid "WP VR" | |
| 1530 | +msgstr "WP VR" | |
| 1531 | + | |
| 1532 | +#: legacy/admin/classes/class-wpvr-post-type.php:428 | |
| 1533 | +#, fuzzy | |
| 1534 | +msgid "Title" | |
| 1535 | +msgstr "Tytuł sceny" | |
| 1536 | + | |
| 1537 | +#: legacy/admin/classes/class-wpvr-post-type.php:429 | |
| 1538 | +msgid "Tour Thumbnail" | |
| 639 | 1539 | msgstr "" |
| 640 | 1540 | |
| 641 | -#: admin/classes/class-wpvr-meta-field.php:832 | |
| 642 | -msgid "Gyroscope" | |
| 1541 | +#: legacy/admin/classes/class-wpvr-post-type.php:430 | |
| 1542 | +#, fuzzy | |
| 1543 | +msgid "Shortcode" | |
| 1544 | +msgstr "Dodaj krótki kod formularza" | |
| 1545 | + | |
| 1546 | +#: legacy/admin/classes/class-wpvr-post-type.php:431 src/Admin/Admin.php:514 | |
| 1547 | +msgid "Tour Type" | |
| 643 | 1548 | msgstr "" |
| 644 | 1549 | |
| 645 | -#: admin/partials/wpvr_setup_wizard.php:183 | |
| 646 | -msgid "Gyroscope & Mobile Notices" | |
| 1550 | +#: legacy/admin/classes/class-wpvr-post-type.php:432 | |
| 1551 | +msgid "Author" | |
| 647 | 1552 | msgstr "" |
| 648 | 1553 | |
| 649 | -#: admin/classes/class-wpvr-meta-field.php:672 | |
| 650 | -msgid "Gyroscope Control" | |
| 1554 | +#: legacy/admin/classes/class-wpvr-post-type.php:433 | |
| 1555 | +msgid "Date" | |
| 651 | 1556 | msgstr "" |
| 652 | 1557 | |
| 653 | -#: admin/partials/wpvr_documentation.php:347 | |
| 1558 | +#: legacy/admin/classes/class-wpvr-post-type.php:597 | |
| 1559 | +#: legacy/admin/classes/class-wpvr-post-type.php:598 | |
| 1560 | +msgid "WP VR item updated." | |
| 1561 | +msgstr "" | |
| 1562 | + | |
| 1563 | +#: legacy/admin/classes/class-wpvr-sample-tour.php:75 | |
| 1564 | +msgid "Failed to initialize WP_Filesystem" | |
| 1565 | +msgstr "" | |
| 1566 | + | |
| 1567 | +#: legacy/admin/classes/class-wpvr-scene.php:232 | |
| 1568 | +#: legacy/admin/classes/class-wpvr-scene.php:261 | |
| 654 | 1569 | #, fuzzy |
| 655 | -#| msgid "Gyroscope support" | |
| 656 | -msgid "Gyroscope Support" | |
| 657 | -msgstr "Wsparcie żyroskopu" | |
| 1570 | +msgid "Scene Settings" | |
| 1571 | +msgstr "Ustawienie sceny" | |
| 658 | 1572 | |
| 659 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:147 | |
| 660 | -msgid "Height" | |
| 1573 | +#: legacy/admin/classes/class-wpvr-scene.php:672 | |
| 1574 | +#: legacy/bricks/Wpvr-widget.php:186 | |
| 1575 | +msgid "Bricks Editor Mode - WPVR Preview is not available." | |
| 661 | 1576 | msgstr "" |
| 662 | 1577 | |
| 663 | -#: oxygen/elements/Wpvr_Tour_Element.php:51 | |
| 664 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:155 | |
| 665 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:156 | |
| 666 | -msgid "Height Unit" | |
| 1578 | +#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:82 | |
| 1579 | +msgid "Close banner" | |
| 667 | 1580 | msgstr "" |
| 668 | 1581 | |
| 669 | -#: elementor/elements/Wpvr-widget.php:175 | |
| 670 | -msgid "Height:" | |
| 671 | -msgstr "Wysokość:" | |
| 1582 | +#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:108 | |
| 1583 | +msgid "Eid Mubarak, Save Big" | |
| 1584 | +msgstr "" | |
| 672 | 1585 | |
| 673 | -#: admin/classes/class-tour-guide-translation.php:30 | |
| 674 | -msgid "" | |
| 675 | -"Here is a preview of your panorama image in tour mode. You can control it " | |
| 676 | -"and mode around to see it in 360 degree view." | |
| 1586 | +#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:113 | |
| 1587 | +msgid "Up to 50% Off" | |
| 677 | 1588 | msgstr "" |
| 678 | 1589 | |
| 679 | -#: admin/classes/class-tour-guide-translation.php:59 | |
| 680 | -#: admin/classes/class-tour-guide-translation.php:63 | |
| 681 | -msgid "Here you can see the Pitch & Yaw has been set for the hotspot." | |
| 1590 | +#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:145 | |
| 1591 | +msgid "Claim Your Deal on Eid-Ul-Fitr" | |
| 682 | 1592 | msgstr "" |
| 683 | 1593 | |
| 684 | -#: admin/classes/class-tour-guide-translation.php:67 | |
| 685 | -#: admin/classes/class-tour-guide-translation.php:71 | |
| 1594 | +#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:146 | |
| 1595 | +msgid "Claim Your Deal" | |
| 1596 | +msgstr "" | |
| 1597 | + | |
| 1598 | +#: legacy/admin/classes/class-wpvr-shortcode.php:36 | |
| 1599 | +msgid "For Classic Editor:" | |
| 1600 | +msgstr "Dla klasycznego edytora:" | |
| 1601 | + | |
| 1602 | +#: legacy/admin/classes/class-wpvr-shortcode.php:39 | |
| 686 | 1603 | msgid "" |
| 687 | -"Here, you can set what content your viewer will see after clicking on the " | |
| 688 | -"Hotspot. You can either set an URL or any other content using this editor. " | |
| 689 | -"To learn more, follow this guide to set content using editor" | |
| 1604 | +"To use this WP VR tour in your posts or pages use the following shortcode " | |
| 690 | 1605 | msgstr "" |
| 1606 | +"Aby użyć tego WP VR Tour w swoich postach lub stronach, użyj następującego " | |
| 1607 | +"skrótu kodu" | |
| 691 | 1608 | |
| 692 | -#: admin/classes/class-wpvr-meta-field.php:838 | |
| 693 | -msgid "Home" | |
| 1609 | +#: legacy/admin/classes/class-wpvr-video.php:46 | |
| 1610 | +msgid "Video Settings : " | |
| 1611 | +msgstr "Ustawienia wideo:" | |
| 1612 | + | |
| 1613 | +#: legacy/admin/classes/class-wpvr-video.php:93 | |
| 1614 | +#: legacy/admin/classes/class-wpvr-video.php:152 | |
| 1615 | +msgid "panoid" | |
| 694 | 1616 | msgstr "" |
| 695 | 1617 | |
| 696 | -#: admin/partials/wpvr_documentation.php:698 | |
| 697 | -msgid "Home Button to visit Default Scene" | |
| 1618 | +#: legacy/admin/classes/class-wpvr-video.php:94 | |
| 1619 | +msgid "panoviddata" | |
| 698 | 1620 | msgstr "" |
| 699 | 1621 | |
| 700 | -#: admin/partials/wpvr_setup_wizard.php:125 | |
| 701 | -msgid "Hook" | |
| 1622 | +#: legacy/admin/classes/class-wpvr-video.php:95 | |
| 1623 | +#: legacy/admin/classes/class-wpvr-video.php:152 | |
| 1624 | +msgid "vidid" | |
| 702 | 1625 | msgstr "" |
| 703 | 1626 | |
| 704 | -#: admin/classes/class-wpvr-meta-field.php:97 | |
| 705 | -msgid "Hotspot" | |
| 1627 | +#: legacy/admin/classes/class-wpvr-video.php:96 | |
| 1628 | +msgid "vidurl" | |
| 706 | 1629 | msgstr "" |
| 707 | 1630 | |
| 708 | -#: admin/classes/class-wpvr-meta-field.php:978 | |
| 709 | -msgid "Hotspot Custom Icon Class" | |
| 1631 | +#: legacy/admin/classes/class-wpvr-video.php:97 | |
| 1632 | +#: legacy/admin/classes/class-wpvr-video.php:152 | |
| 1633 | +msgid "vidtype" | |
| 710 | 1634 | msgstr "" |
| 711 | 1635 | |
| 712 | -#: admin/classes/class-wpvr-meta-field.php:957 | |
| 713 | -msgid "Hotspot ID" | |
| 1636 | +#: legacy/admin/classes/class-wpvr-video.php:98 | |
| 1637 | +msgid "autoplay" | |
| 714 | 1638 | msgstr "" |
| 715 | 1639 | |
| 716 | -#: admin/classes/class-wpvr-hotspot.php:109 | |
| 717 | -#: admin/classes/class-wpvr-hotspot.php:169 | |
| 718 | -msgid "Hotspot Setting" | |
| 1640 | +#: legacy/admin/classes/class-wpvr-video.php:99 | |
| 1641 | +msgid "loop" | |
| 719 | 1642 | msgstr "" |
| 720 | 1643 | |
| 721 | -#: admin/classes/class-wpvr-meta-field.php:999 | |
| 722 | -#: admin/classes/class-wpvr-meta-field.php:1055 | |
| 723 | -#: admin/classes/class-wpvr-meta-field.php:1116 | |
| 724 | -#: admin/classes/class-wpvr-meta-field.php:1182 | |
| 725 | -#: admin/classes/class-wpvr-meta-field.php:1248 | |
| 726 | -msgid "Hotspot-Type" | |
| 1644 | +#: legacy/admin/classes/class-wpvr-video.php:152 | |
| 1645 | +msgid "panodata" | |
| 727 | 1646 | msgstr "" |
| 728 | 1647 | |
| 729 | -#. Author URI of the plugin | |
| 730 | -msgid "http://rextheme.com/" | |
| 731 | -msgstr "http://rextheme.com/" | |
| 1648 | +#: legacy/admin/partials/wpvr-premium-feature-popup.php:54 | |
| 1649 | +#: legacy/admin/partials/wpvr_confirmation_alert.php:510 | |
| 1650 | +#, fuzzy | |
| 1651 | +msgid "This is a Premium Feature" | |
| 1652 | +msgstr "Funkcje premium" | |
| 732 | 1653 | |
| 733 | -#. URI of the plugin | |
| 734 | -msgid "https://rextheme.com/wpvr/" | |
| 735 | -msgstr "https://rextheme.com/wpvr/" | |
| 1654 | +#: legacy/admin/partials/wpvr-premium-feature-popup.php:58 | |
| 1655 | +#: legacy/admin/partials/wpvr_confirmation_alert.php:514 | |
| 1656 | +msgid "Upgrade to Pro to unlock this and start using the feature." | |
| 1657 | +msgstr "" | |
| 736 | 1658 | |
| 737 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:91 | |
| 738 | -msgid "ID" | |
| 1659 | +#. translators: %s: Discount price | |
| 1660 | +#: legacy/admin/partials/wpvr-premium-feature-popup.php:83 | |
| 1661 | +#: legacy/admin/partials/wpvr_confirmation_alert.php:539 | |
| 1662 | +#, php-format | |
| 1663 | +msgid "Starting at %s/year" | |
| 739 | 1664 | msgstr "" |
| 740 | 1665 | |
| 741 | -#: elementor/elements/Wpvr-widget.php:157 | |
| 742 | -msgid "ID:" | |
| 743 | -msgstr "ID:" | |
| 1666 | +#. translators: %s: Original price | |
| 1667 | +#: legacy/admin/partials/wpvr-premium-feature-popup.php:87 | |
| 1668 | +#: legacy/admin/partials/wpvr_confirmation_alert.php:543 | |
| 1669 | +#, php-format | |
| 1670 | +msgid "Normally %s/year" | |
| 1671 | +msgstr "" | |
| 744 | 1672 | |
| 745 | -#: admin/classes/class-wpvr-meta-field.php:683 | |
| 1673 | +#: legacy/admin/partials/wpvr-premium-feature-popup.php:94 | |
| 1674 | +#: legacy/admin/partials/wpvr_confirmation_alert.php:550 | |
| 1675 | +#, fuzzy | |
| 1676 | +msgid "Upgrade to PRO Now" | |
| 1677 | +msgstr "Uaktualnij do Pro" | |
| 1678 | + | |
| 1679 | +#: legacy/admin/partials/wpvr-review-request-body-content.php:4 | |
| 746 | 1680 | msgid "" |
| 747 | -"If set to true, device orientation control will be used when the panorama is " | |
| 748 | -"loaded, if the device supports it. If false, device orientation control " | |
| 749 | -"needs to be activated by pressing a button. Defaults to false. Will work if " | |
| 750 | -"gyroscope is enabled" | |
| 1681 | +"Hey, I noticed you've made nice tour with WP VR! Are you enjoying WP VR?" | |
| 751 | 1682 | msgstr "" |
| 752 | 1683 | |
| 753 | -#: admin/partials/wpvr_documentation.php:137 | |
| 754 | -msgid "Import" | |
| 755 | -msgstr "Import" | |
| 1684 | +#: legacy/admin/partials/wpvr-review-request-body-content.php:7 | |
| 1685 | +msgid "Not Really" | |
| 1686 | +msgstr "" | |
| 756 | 1687 | |
| 757 | -#: admin/partials/wpvr_documentation.php:607 | |
| 758 | -msgid "Import & Export Virtual Tours" | |
| 1688 | +#: legacy/admin/partials/wpvr-review-request-body-content.php:18 | |
| 1689 | +msgid "" | |
| 1690 | +"That's awesome! Could you please do me a BIG favor and give it a rating on " | |
| 1691 | +"WordPress to help us grow and motivate us?" | |
| 759 | 1692 | msgstr "" |
| 760 | 1693 | |
| 761 | -#: admin/partials/wpvr_documentation.php:762 | |
| 762 | -msgid "Import tour file: " | |
| 763 | -msgstr "Importuj plik wycieczki:" | |
| 1694 | +#: legacy/admin/partials/wpvr-review-request-body-content.php:18 | |
| 1695 | +msgid "Lincoln Islam" | |
| 1696 | +msgstr "" | |
| 764 | 1697 | |
| 765 | -#: admin/classes/class-tour-guide-translation.php:51 | |
| 766 | -msgid "" | |
| 767 | -"In this Preview, drag to your desired location and click on it, exactly " | |
| 768 | -"where you want to set the hotspot" | |
| 1698 | +#: legacy/admin/partials/wpvr-review-request-body-content.php:21 | |
| 1699 | +msgid "Already given" | |
| 769 | 1700 | msgstr "" |
| 770 | 1701 | |
| 771 | -#: admin/partials/wpvr_documentation.php:97 | |
| 772 | -msgid "Info" | |
| 1702 | +#: legacy/admin/partials/wpvr-review-request-body-content.php:22 | |
| 1703 | +msgid "No thanks" | |
| 773 | 1704 | msgstr "" |
| 774 | 1705 | |
| 775 | -#: admin/partials/wpvr_documentation.php:402 | |
| 776 | -msgid "Info-type Hotspots (Heading, Image, Text, Video, Gif, Links)" | |
| 1706 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:17 | |
| 1707 | +#, fuzzy | |
| 1708 | +msgid "WP VR - Setup Wizard" | |
| 1709 | +msgstr "Konfiguracja WPVR" | |
| 1710 | + | |
| 1711 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:35 | |
| 1712 | +msgid "Remind me later" | |
| 777 | 1713 | msgstr "" |
| 778 | 1714 | |
| 779 | -#: admin/classes/class-wpvr-meta-field.php:3097 | |
| 780 | -msgid "Italic" | |
| 1715 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:56 | |
| 1716 | +msgid "What are you creating a virtual tour for?" | |
| 781 | 1717 | msgstr "" |
| 782 | 1718 | |
| 783 | -#: admin/classes/class-wpvr-meta-field.php:3089 | |
| 784 | -msgid "Justified" | |
| 1719 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:57 | |
| 1720 | +msgid "We'll set things up with the right template for you." | |
| 785 | 1721 | msgstr "" |
| 786 | 1722 | |
| 787 | -#: admin/classes/class-wpvr-meta-field.php:640 | |
| 788 | -msgid "Keyboard Movement Control" | |
| 1723 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:62 | |
| 1724 | +msgid "Real Estate" | |
| 789 | 1725 | msgstr "" |
| 790 | 1726 | |
| 791 | -#: admin/classes/class-wpvr-meta-field.php:648 | |
| 792 | -msgid "Keyboard Zoom Control" | |
| 1727 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:63 | |
| 1728 | +msgid "Show property without a visit" | |
| 793 | 1729 | msgstr "" |
| 794 | 1730 | |
| 795 | -#: admin/partials/wpvr_setup_wizard.php:54 | |
| 796 | -#: admin/partials/wpvr_setup_wizard.php:66 | |
| 797 | -#: admin/partials/wpvr_setup_wizard.php:78 | |
| 798 | -#: admin/partials/wpvr_setup_wizard.php:90 | |
| 799 | -#: admin/partials/wpvr_setup_wizard.php:102 | |
| 800 | -msgid "Learn more" | |
| 1731 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:67 | |
| 1732 | +msgid "Hotels & Resorts" | |
| 801 | 1733 | msgstr "" |
| 802 | 1734 | |
| 803 | -#: admin/classes/class-wpvr-meta-field.php:3086 | |
| 804 | -#: admin/classes/class-wpvr-meta-field.php:3161 | |
| 805 | -msgid "Left" | |
| 1735 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:68 | |
| 1736 | +msgid "Experience before booking" | |
| 806 | 1737 | msgstr "" |
| 807 | 1738 | |
| 808 | -#: admin/classes/class-tour-guide-translation.php:42 | |
| 809 | -msgid "Let's add a Hotspot" | |
| 1739 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:72 | |
| 1740 | +msgid "Educational Institutions" | |
| 810 | 1741 | msgstr "" |
| 811 | 1742 | |
| 812 | -#: admin/classes/class-wpvr-meta-field.php:3103 | |
| 813 | -msgid "Letter Spacing (px)" | |
| 1743 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:73 | |
| 1744 | +msgid "Campus tours & admissions" | |
| 814 | 1745 | msgstr "" |
| 815 | 1746 | |
| 816 | -#: admin/partials/wpvr_license.php:18 | |
| 817 | -msgid "License Key" | |
| 818 | -msgstr "Klucz licencyjny" | |
| 1747 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:77 | |
| 1748 | +msgid "E-commerce" | |
| 1749 | +msgstr "" | |
| 819 | 1750 | |
| 820 | -#: admin/classes/class-wpvr-meta-field.php:3059 | |
| 821 | -msgid "Line Height" | |
| 1751 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:78 | |
| 1752 | +msgid "Virtual shopping experience" | |
| 822 | 1753 | msgstr "" |
| 823 | 1754 | |
| 824 | -#: admin/classes/class-wpvr-meta-field.php:3069 | |
| 825 | -msgid "Line Through" | |
| 1755 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:82 | |
| 1756 | +msgid "Exhibitions" | |
| 826 | 1757 | msgstr "" |
| 827 | 1758 | |
| 828 | -#: admin/partials/wpvr_documentation.php:988 | |
| 829 | -msgid "" | |
| 830 | -"List of allowed pages to load WP VR scripts (The URLs of the pages on your " | |
| 831 | -"site with virtual tours):" | |
| 1759 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:83 | |
| 1760 | +msgid "Art & gallery showcases" | |
| 832 | 1761 | msgstr "" |
| 833 | 1762 | |
| 834 | -#: admin/partials/wpvr_documentation.php:1028 | |
| 835 | -msgid "" | |
| 836 | -"List of allowed pages to load WP VR Video JS library (The URLs of the pages " | |
| 837 | -"on your site, You want to load Video JS):" | |
| 1763 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:87 | |
| 1764 | +msgid "Offices" | |
| 838 | 1765 | msgstr "" |
| 839 | 1766 | |
| 840 | -#: admin/partials/wpvr_documentation.php:1034 | |
| 841 | -msgid "" | |
| 842 | -"List the pages like this: https://example.com/tour1/, https://example." | |
| 843 | -"com/tour2/" | |
| 1767 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:88 | |
| 1768 | +msgid "Virtual office tours" | |
| 844 | 1769 | msgstr "" |
| 845 | 1770 | |
| 846 | -#: admin/partials/wpvr_documentation.php:994 | |
| 847 | -msgid "" | |
| 848 | -"List the pages with virtual tours like this: https://example.com/tour1/, " | |
| 849 | -"https://example.com/tour2/" | |
| 1771 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:92 | |
| 1772 | +msgid "Showrooms" | |
| 850 | 1773 | msgstr "" |
| 851 | 1774 | |
| 852 | -#: admin/classes/class-wpvr-meta-field.php:3078 | |
| 853 | -msgid "Lowercase" | |
| 1775 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:93 | |
| 1776 | +msgid "Virtual showroom experiences" | |
| 854 | 1777 | msgstr "" |
| 855 | 1778 | |
| 856 | -#: admin/partials/wpvr_documentation.php:220 | |
| 857 | -msgid "Make WPVR Popular" | |
| 858 | -msgstr "Uczyń WPVR popularnym" | |
| 1779 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:98 | |
| 1780 | +msgid "Skip — I'll upload my own image" | |
| 1781 | +msgstr "" | |
| 859 | 1782 | |
| 860 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:192 | |
| 861 | -msgid "Mobile Height" | |
| 1783 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:112 | |
| 1784 | +msgid "Show your property without another site visit" | |
| 862 | 1785 | msgstr "" |
| 863 | 1786 | |
| 864 | -#: oxygen/elements/Wpvr_Tour_Element.php:118 | |
| 865 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:200 | |
| 866 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:201 | |
| 867 | -msgid "Mobile Height Unit" | |
| 1787 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:113 | |
| 1788 | +msgid "Most agents publish their first property tour in minutes." | |
| 868 | 1789 | msgstr "" |
| 869 | 1790 | |
| 870 | -#: admin/partials/wpvr_setup_wizard.php:63 | |
| 871 | -msgid "Mobile Panorama" | |
| 1791 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:121 | |
| 1792 | +msgid "Upload my own 360 photo" | |
| 872 | 1793 | msgstr "" |
| 873 | 1794 | |
| 874 | -#: admin/partials/wpvr_documentation.php:694 | |
| 875 | -msgid "More Pro Features" | |
| 1795 | +#. translators: %s: link to browse | |
| 1796 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:127 | |
| 1797 | +#, php-format | |
| 1798 | +msgid "Drag & drop your 360° image or %s" | |
| 876 | 1799 | msgstr "" |
| 877 | 1800 | |
| 878 | -#: admin/partials/wpvr_documentation.php:726 | |
| 879 | -msgid "Mouse Control." | |
| 1801 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:128 | |
| 1802 | +msgid "click to browse" | |
| 880 | 1803 | msgstr "" |
| 881 | 1804 | |
| 882 | -#: admin/classes/class-wpvr-meta-field.php:656 | |
| 883 | -msgid "Mouse Drag Control" | |
| 1805 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:136 | |
| 1806 | +msgid "Supported files: JPEG, PNG, WebP" | |
| 884 | 1807 | msgstr "" |
| 885 | 1808 | |
| 886 | -#: admin/classes/class-wpvr-meta-field.php:664 | |
| 887 | -msgid "Mouse Zoom Control" | |
| 1809 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:141 | |
| 1810 | +msgid "USE PROPERTY TEMPLATE" | |
| 888 | 1811 | msgstr "" |
| 889 | 1812 | |
| 890 | -#: admin/classes/class-wpvr-meta-field.php:783 | |
| 891 | -msgid "Move Down" | |
| 1813 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:148 | |
| 1814 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:208 | |
| 1815 | +msgid "Back" | |
| 892 | 1816 | msgstr "" |
| 893 | 1817 | |
| 894 | -#: admin/classes/class-wpvr-meta-field.php:789 | |
| 895 | -msgid "Move Left" | |
| 1818 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:159 | |
| 1819 | +msgid "This is how buyers will experience your listing" | |
| 896 | 1820 | msgstr "" |
| 897 | 1821 | |
| 898 | -#: admin/classes/class-wpvr-meta-field.php:795 | |
| 899 | -msgid "Move Right" | |
| 1822 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:160 | |
| 1823 | +msgid "Interactive, immersive, and accessible on any device." | |
| 900 | 1824 | msgstr "" |
| 901 | 1825 | |
| 902 | -#: admin/classes/class-wpvr-meta-field.php:777 | |
| 903 | -msgid "Move Up" | |
| 1826 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:166 | |
| 1827 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:173 | |
| 1828 | +msgid "Drag to rotate" | |
| 904 | 1829 | msgstr "" |
| 905 | 1830 | |
| 906 | -#: admin/partials/wpvr_setup_wizard.php:148 | |
| 907 | -msgid "Multiple Content on Hotspots" | |
| 1831 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:167 | |
| 1832 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:174 | |
| 1833 | +msgid "Scroll to zoom" | |
| 908 | 1834 | msgstr "" |
| 909 | 1835 | |
| 910 | -#: admin/classes/class-tour-guide-translation.php:8 | |
| 911 | -msgid "Next" | |
| 1836 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:168 | |
| 1837 | +#, fuzzy | |
| 1838 | +msgid "Click to add hotspot" | |
| 1839 | +msgstr "Dodajmy hotspot" | |
| 1840 | + | |
| 1841 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:191 | |
| 1842 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:199 | |
| 1843 | +#, fuzzy | |
| 1844 | +msgid "Add Hotspot" | |
| 1845 | +msgstr "gorący miejsce" | |
| 1846 | + | |
| 1847 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:195 | |
| 1848 | +#, fuzzy | |
| 1849 | +msgid "Hotspot Text" | |
| 1850 | +msgstr "Hotspot-typ" | |
| 1851 | + | |
| 1852 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:196 | |
| 1853 | +msgid "Enter information about this location..." | |
| 912 | 1854 | msgstr "" |
| 913 | 1855 | |
| 914 | -#: admin/classes/class-wpvr-meta-field.php:1651 | |
| 915 | -#: admin/partials/wpvr_confirmation_alert.php:26 | |
| 916 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:137 | |
| 917 | -msgid "No" | |
| 1856 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:211 | |
| 1857 | +#, fuzzy | |
| 1858 | +msgid "Publish Tour" | |
| 1859 | +msgstr "Opublikuj swoją wycieczkę" | |
| 1860 | + | |
| 1861 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:221 | |
| 1862 | +msgid "Your tour is published!" | |
| 918 | 1863 | msgstr "" |
| 919 | 1864 | |
| 920 | -#: admin/classes/class-wpvr-meta-field.php:3066 | |
| 921 | -#: admin/classes/class-wpvr-meta-field.php:3076 | |
| 922 | -msgid "None" | |
| 1865 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:222 | |
| 1866 | +msgid "" | |
| 1867 | +"Your virtual tour has been created and is ready to be displayed on your " | |
| 1868 | +"website." | |
| 923 | 1869 | msgstr "" |
| 924 | 1870 | |
| 925 | -#: admin/classes/class-wpvr-meta-field.php:3096 | |
| 926 | -msgid "Normal" | |
| 1871 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:229 | |
| 1872 | +#, fuzzy | |
| 1873 | +msgid "Edit Your Tour" | |
| 1874 | +msgstr "Zapisz swoją wycieczkę" | |
| 1875 | + | |
| 1876 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:237 | |
| 1877 | +msgid "I agree to share non-sensitive diagnostic data to help improve WP VR." | |
| 927 | 1878 | msgstr "" |
| 928 | 1879 | |
| 929 | -#: admin/classes/class-wpvr-meta-field.php:3098 | |
| 930 | -msgid "Oblique" | |
| 1880 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:238 | |
| 1881 | +msgid "(You can change this in WP VR settings anytime)" | |
| 931 | 1882 | msgstr "" |
| 932 | 1883 | |
| 933 | -#: oxygen/elements/Wpvr_Tour_Element.php:89 | |
| 934 | -msgid "OFF" | |
| 1884 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:244 | |
| 1885 | +msgid "Start Over" | |
| 935 | 1886 | msgstr "" |
| 936 | 1887 | |
| 937 | -#: oxygen/elements/Wpvr_Tour_Element.php:88 | |
| 938 | -msgid "ON" | |
| 1888 | +#: legacy/admin/partials/wpvr-setup-wizard-views.php:246 | |
| 1889 | +msgid "Go to listing" | |
| 939 | 1890 | msgstr "" |
| 940 | 1891 | |
| 941 | -#: admin/classes/class-wpvr-meta-field.php:1016 | |
| 942 | -#: admin/classes/class-wpvr-meta-field.php:1072 | |
| 943 | -#: admin/classes/class-wpvr-meta-field.php:1139 | |
| 944 | -#: admin/classes/class-wpvr-meta-field.php:1205 | |
| 945 | -#: admin/classes/class-wpvr-meta-field.php:1265 | |
| 946 | -msgid "On Click Content" | |
| 1892 | +#: legacy/admin/partials/wpvr_checklist_template.php:16 | |
| 1893 | +#, fuzzy | |
| 1894 | +msgid "Add at least one scene" | |
| 1895 | +msgstr "Dodawanie hotspotów na scenie" | |
| 1896 | + | |
| 1897 | +#: legacy/admin/partials/wpvr_checklist_template.php:27 | |
| 1898 | +msgid "Upload your first 360° image or video." | |
| 947 | 1899 | msgstr "" |
| 948 | 1900 | |
| 949 | -#: admin/classes/class-wpvr-meta-field.php:1021 | |
| 950 | -#: admin/classes/class-wpvr-meta-field.php:1079 | |
| 951 | -#: admin/classes/class-wpvr-meta-field.php:1146 | |
| 952 | -#: admin/classes/class-wpvr-meta-field.php:1212 | |
| 953 | -#: admin/classes/class-wpvr-meta-field.php:1271 | |
| 954 | -msgid "On Hover Content" | |
| 1901 | +#: legacy/admin/partials/wpvr_checklist_template.php:36 | |
| 1902 | +msgid "Upload 360° media" | |
| 955 | 1903 | msgstr "" |
| 956 | 1904 | |
| 957 | -#: admin/partials/wpvr_documentation.php:730 | |
| 958 | -msgid "On Screen Compass." | |
| 1905 | +#: legacy/admin/partials/wpvr_checklist_template.php:47 | |
| 1906 | +msgid "Ensure media is self-hosted or from YouTube/Vimeo." | |
| 959 | 1907 | msgstr "" |
| 960 | 1908 | |
| 961 | -#: admin/classes/class-tour-guide-translation.php:55 | |
| 962 | -msgid "" | |
| 963 | -"Once you see the Pitch & Yaw value for the spot, click on this Arrow. It'll " | |
| 964 | -"be set as the coordinate for your hotspot" | |
| 1909 | +#: legacy/admin/partials/wpvr_checklist_template.php:56 | |
| 1910 | +#, fuzzy | |
| 1911 | +msgid "Set a default scene" | |
| 1912 | +msgstr "Ustaw jako domyślny" | |
| 1913 | + | |
| 1914 | +#: legacy/admin/partials/wpvr_checklist_template.php:67 | |
| 1915 | +msgid "Choose where users will start the tour." | |
| 965 | 1916 | msgstr "" |
| 966 | 1917 | |
| 967 | -#: wpvr.php:261 public/classes/class-wpvr-shortcode.php:98 | |
| 968 | -msgid "" | |
| 969 | -"Oops! It seems like this post isn't published yet. Stay tuned for updates!" | |
| 1918 | +#: legacy/admin/partials/wpvr_checklist_template.php:76 | |
| 1919 | +msgid "Add navigation hotspots" | |
| 970 | 1920 | msgstr "" |
| 971 | 1921 | |
| 972 | -#: admin/classes/class-wpvr-meta-field.php:3025 | |
| 973 | -msgid "Open in new tab" | |
| 1922 | +#: legacy/admin/partials/wpvr_checklist_template.php:87 | |
| 1923 | +msgid "Link different scenes or add interactive elements." | |
| 974 | 1924 | msgstr "" |
| 975 | 1925 | |
| 976 | -#: admin/classes/class-wpvr-meta-field.php:1009 | |
| 977 | -#: admin/classes/class-wpvr-meta-field.php:1065 | |
| 978 | -#: admin/classes/class-wpvr-meta-field.php:1132 | |
| 979 | -#: admin/classes/class-wpvr-meta-field.php:1198 | |
| 980 | -#: admin/classes/class-wpvr-meta-field.php:1258 | |
| 981 | -msgid "Open in same tab" | |
| 1926 | +#: legacy/admin/partials/wpvr_checklist_template.php:96 | |
| 1927 | +msgid "Enable basic controls" | |
| 982 | 1928 | msgstr "" |
| 983 | 1929 | |
| 984 | -#: admin/classes/class-wpvr-meta-field.php:3068 | |
| 985 | -msgid "Overline" | |
| 1930 | +#: legacy/admin/partials/wpvr_checklist_template.php:107 | |
| 1931 | +msgid "Allow movement within the tour." | |
| 986 | 1932 | msgstr "" |
| 987 | 1933 | |
| 988 | -#: admin/classes/class-wpvr-meta-field.php:3143 | |
| 989 | -msgid "Padding (px)" | |
| 1934 | +#: legacy/admin/partials/wpvr_checklist_template.php:116 | |
| 1935 | +#, fuzzy | |
| 1936 | +msgid "Enable zoom controls" | |
| 1937 | +msgstr "Włącz lub wyłącz kontrolę zoomu myszy." | |
| 1938 | + | |
| 1939 | +#: legacy/admin/partials/wpvr_checklist_template.php:127 | |
| 1940 | +msgid "Allow zooming within the tour." | |
| 990 | 1941 | msgstr "" |
| 991 | 1942 | |
| 992 | -#: admin/partials/wpvr_documentation.php:361 | |
| 993 | -#: admin/partials/wpvr_setup_wizard.php:134 | |
| 1943 | +#: legacy/admin/partials/wpvr_checklist_template.php:137 | |
| 1944 | +#, fuzzy | |
| 1945 | +msgid "Publish the tour" | |
| 1946 | +msgstr "Opublikuj swoją wycieczkę" | |
| 1947 | + | |
| 1948 | +#: legacy/admin/partials/wpvr_checklist_template.php:148 | |
| 1949 | +msgid "Publish your tour and embed it anywhere on your site." | |
| 1950 | +msgstr "" | |
| 1951 | + | |
| 1952 | +#: legacy/admin/partials/wpvr_confirmation_alert.php:426 | |
| 1953 | +#, fuzzy | |
| 1954 | +msgid "Layout Settings" | |
| 1955 | +msgstr "Ustawienie" | |
| 1956 | + | |
| 1957 | +#: legacy/admin/partials/wpvr_confirmation_alert.php:431 | |
| 1958 | +#, fuzzy | |
| 1959 | +msgid "Icon background Color:" | |
| 1960 | +msgstr "Kolor tła" | |
| 1961 | + | |
| 1962 | +#: legacy/admin/partials/wpvr_confirmation_alert.php:441 | |
| 1963 | +#, fuzzy | |
| 1964 | +msgid "Icon Color:" | |
| 1965 | +msgstr "Kolor tła" | |
| 1966 | + | |
| 1967 | +#: legacy/admin/partials/wpvr_confirmation_alert.php:452 | |
| 1968 | +#, fuzzy | |
| 1969 | +msgid "Apply Style" | |
| 1970 | +msgstr "wskazówka zegar" | |
| 1971 | + | |
| 1972 | +#: legacy/admin/partials/wpvr_documentation.php:33 | |
| 1973 | +msgid "Unlimited Scenes (Up to 5 in Free)" | |
| 1974 | +msgstr "Nieograniczone sceny (do 5 w darmowym)" | |
| 1975 | + | |
| 1976 | +#: legacy/admin/partials/wpvr_documentation.php:34 | |
| 1977 | +msgid "Unlimited Hotspots (Up to to 5 for a scene in free)" | |
| 1978 | +msgstr "Nieograniczone hotspoty (do 5 za scenę za darmo)" | |
| 1979 | + | |
| 1980 | +#: legacy/admin/partials/wpvr_documentation.php:35 | |
| 1981 | +msgid "Publish Tours Anywhere (Embed Add-on)" | |
| 1982 | +msgstr "Publikuj wycieczki w dowolnym miejscu (dodatk do osadzenia)" | |
| 1983 | + | |
| 1984 | +#: legacy/admin/partials/wpvr_documentation.php:36 | |
| 1985 | +msgid "WooCommerce Add-on" | |
| 1986 | +msgstr "Dodatek WooCommerce" | |
| 1987 | + | |
| 1988 | +#: legacy/admin/partials/wpvr_documentation.php:37 | |
| 1989 | +msgid "Gyroscope Support" | |
| 1990 | +msgstr "Wsparcie żyroskopu" | |
| 1991 | + | |
| 1992 | +#: legacy/admin/partials/wpvr_documentation.php:38 | |
| 994 | 1993 | msgid "Panorama Scene Gallery" |
| 1994 | +msgstr "Galeria scen panoramicznych" | |
| 1995 | + | |
| 1996 | +#: legacy/admin/partials/wpvr_documentation.php:39 | |
| 1997 | +msgid "Explainer Video" | |
| 1998 | +msgstr "Wyjaśnienie wideo" | |
| 1999 | + | |
| 2000 | +#: legacy/admin/partials/wpvr_documentation.php:40 | |
| 2001 | +msgid "Tour Background Audio" | |
| 2002 | +msgstr "Wycieczka dźwięk w tle" | |
| 2003 | + | |
| 2004 | +#: legacy/admin/partials/wpvr_documentation.php:41 | |
| 2005 | +msgid "Info-type Hotspots (Heading, Image, Text, Video, Gif, Links)" | |
| 2006 | +msgstr "Hotspoty typu info (nagłówek, obraz, tekst, wideo, GIF, linki)" | |
| 2007 | + | |
| 2008 | +#: legacy/admin/partials/wpvr_documentation.php:42 | |
| 2009 | +msgid "Scene-type Hotspots (Connect Panoramas)" | |
| 2010 | +msgstr "Hotspoty typu sceny (Połącz panoramy)" | |
| 2011 | + | |
| 2012 | +#: legacy/admin/partials/wpvr_documentation.php:43 | |
| 2013 | +msgid "Custom Icon & Color for Hotspots (Using CSS)" | |
| 2014 | +msgstr "Niestandardowa ikona i kolor dla hotspotów (przy użyciu CSS)" | |
| 2015 | + | |
| 2016 | +#: legacy/admin/partials/wpvr_documentation.php:44 | |
| 2017 | +msgid "900+ Icons & RGB Color Support for Hotspots" | |
| 2018 | +msgstr "900+ ikon i obsługa kolorów RGB dla hotspotów" | |
| 2019 | + | |
| 2020 | +#: legacy/admin/partials/wpvr_documentation.php:45 | |
| 2021 | +msgid "Partial Panorama / Mobile Panorama Support" | |
| 2022 | +msgstr "Częściowa Panorama / Mobilna Panorama Wsparcie" | |
| 2023 | + | |
| 2024 | +#: legacy/admin/partials/wpvr_documentation.php:46 | |
| 2025 | +msgid "360 Video Support" | |
| 2026 | +msgstr "Wsparcie wideo 360" | |
| 2027 | + | |
| 2028 | +#: legacy/admin/partials/wpvr_documentation.php:47 | |
| 2029 | +msgid "Google Street View" | |
| 2030 | +msgstr "Widok ulicy Google" | |
| 2031 | + | |
| 2032 | +#: legacy/admin/partials/wpvr_documentation.php:48 | |
| 2033 | +msgid "Cubemap Image Support" | |
| 2034 | +msgstr "Obsługa obrazów CubeMap" | |
| 2035 | + | |
| 2036 | +#: legacy/admin/partials/wpvr_documentation.php:49 | |
| 2037 | +msgid "VR Glass Support for Video Tours" | |
| 2038 | +msgstr "Wsparcie VR Glass dla wideour wycieczek" | |
| 2039 | + | |
| 2040 | +#: legacy/admin/partials/wpvr_documentation.php:50 | |
| 2041 | +msgid "Fluent Forms Add-on" | |
| 2042 | +msgstr "Dodatek Fluent Forms" | |
| 2043 | + | |
| 2044 | +#: legacy/admin/partials/wpvr_documentation.php:51 | |
| 2045 | +msgid "Autoload Tours" | |
| 2046 | +msgstr "Wycieczki z automatycznym ładowaniem" | |
| 2047 | + | |
| 2048 | +#: legacy/admin/partials/wpvr_documentation.php:52 | |
| 2049 | +msgid "Custom Rotation Settings" | |
| 2050 | +msgstr "Niestandardowe ustawienia rotacji" | |
| 2051 | + | |
| 2052 | +#: legacy/admin/partials/wpvr_documentation.php:53 | |
| 2053 | +msgid "Full Page Virtual Tours" | |
| 2054 | +msgstr "Wirtualne wycieczki na całej stronie" | |
| 2055 | + | |
| 2056 | +#: legacy/admin/partials/wpvr_documentation.php:54 | |
| 2057 | +msgid "Custom Preview Image & Text" | |
| 2058 | +msgstr "Niestandardowy obraz podglądu i tekst" | |
| 2059 | + | |
| 2060 | +#: legacy/admin/partials/wpvr_documentation.php:55 | |
| 2061 | +msgid "Company Logo & Description" | |
| 2062 | +msgstr "Logo firmy i opis" | |
| 2063 | + | |
| 2064 | +#: legacy/admin/partials/wpvr_documentation.php:56 | |
| 2065 | +msgid "Import & Export Virtual Tours" | |
| 2066 | +msgstr "Import i eksport wirtualne wycieczki" | |
| 2067 | + | |
| 2068 | +#: legacy/admin/partials/wpvr_documentation.php:57 | |
| 2069 | +msgid "Duplicate Tours with One Click" | |
| 2070 | +msgstr "Powiel wycieczki za jednym kliknięciem" | |
| 2071 | + | |
| 2072 | +#: legacy/admin/partials/wpvr_documentation.php:58 | |
| 2073 | +msgid "Control Horizontal & Vertical View of Panorama Images" | |
| 2074 | +msgstr "Kontroluj poziomy i pionowy widok obrazów panoramicznych" | |
| 2075 | + | |
| 2076 | +#: legacy/admin/partials/wpvr_documentation.php:59 | |
| 2077 | +msgid "Custom Zoom Settings" | |
| 2078 | +msgstr "Niestandardowe ustawienia powiększenia" | |
| 2079 | + | |
| 2080 | +#: legacy/admin/partials/wpvr_documentation.php:60 | |
| 2081 | +msgid "Custom Panorama Loading Face" | |
| 2082 | +msgstr "Niestandardowa twarz ładująca panoramę" | |
| 2083 | + | |
| 2084 | +#: legacy/admin/partials/wpvr_documentation.php:61 | |
| 2085 | +msgid "Background Panoramas" | |
| 2086 | +msgstr "Panoramy w tle" | |
| 2087 | + | |
| 2088 | +#: legacy/admin/partials/wpvr_documentation.php:62 | |
| 2089 | +msgid "Home Button to visit Default Scene" | |
| 2090 | +msgstr "Przycisk Home, aby odwiedzić domyślną scenę" | |
| 2091 | + | |
| 2092 | +#: legacy/admin/partials/wpvr_documentation.php:63 | |
| 2093 | +msgid "Scene Title" | |
| 2094 | +msgstr "Tytuł sceny" | |
| 2095 | + | |
| 2096 | +#: legacy/admin/partials/wpvr_documentation.php:64 | |
| 2097 | +msgid "Scene Author with URL" | |
| 2098 | +msgstr "Autor sceny z adresem URL" | |
| 2099 | + | |
| 2100 | +#: legacy/admin/partials/wpvr_documentation.php:65 | |
| 2101 | +msgid "Enable or Disable Keyboard Movement Control." | |
| 2102 | +msgstr "Włącz lub wyłącz kontrolę ruchu klawiatury." | |
| 2103 | + | |
| 2104 | +#: legacy/admin/partials/wpvr_documentation.php:66 | |
| 2105 | +msgid "Enable or Disable Keyboard Zoom Control." | |
| 2106 | +msgstr "Włącz lub wyłącz kontrolę zoomu klawiatury." | |
| 2107 | + | |
| 2108 | +#: legacy/admin/partials/wpvr_documentation.php:67 | |
| 2109 | +msgid "Enable or Disable Mouse Drag Control." | |
| 2110 | +msgstr "Włącz lub wyłącz kontrolę przeciągania myszy." | |
| 2111 | + | |
| 2112 | +#: legacy/admin/partials/wpvr_documentation.php:68 | |
| 2113 | +msgid "Enable or Disable Mouse Zoom control." | |
| 2114 | +msgstr "Włącz lub wyłącz kontrolę zoomu myszy." | |
| 2115 | + | |
| 2116 | +#: legacy/admin/partials/wpvr_documentation.php:69 | |
| 2117 | +msgid "Mouse Control." | |
| 2118 | +msgstr "Kontrola myszy." | |
| 2119 | + | |
| 2120 | +#: legacy/admin/partials/wpvr_documentation.php:70 | |
| 2121 | +msgid "On Screen Compass." | |
| 2122 | +msgstr "Kompas na ekranie." | |
| 2123 | + | |
| 2124 | +#: legacy/admin/partials/wpvr_documentation.php:71 | |
| 2125 | +msgid "Scene Titles on Gallery." | |
| 2126 | +msgstr "Tytuły scen w galerii." | |
| 2127 | + | |
| 2128 | +#: legacy/admin/partials/wpvr_documentation.php:72 | |
| 2129 | +msgid "Customize Icon & Logo of Control Buttons." | |
| 2130 | +msgstr "Dostosuj ikonę i logo przycisków sterowania." | |
| 2131 | + | |
| 2132 | +#: legacy/admin/partials/wpvr_documentation.php:73 | |
| 2133 | +msgid "Autoload & Autoplay Video Tours." | |
| 2134 | +msgstr "Automatyczne ładowanie i autoodtwarzanie wideo." | |
| 2135 | + | |
| 2136 | +#: legacy/admin/partials/wpvr_documentation.php:93 | |
| 2137 | +msgid "features" | |
| 2138 | +msgstr "zarzut" | |
| 2139 | + | |
| 2140 | +#: legacy/admin/partials/wpvr_documentation.php:94 | |
| 2141 | +msgid "free" | |
| 2142 | +msgstr "bezpłatny" | |
| 2143 | + | |
| 2144 | +#: legacy/admin/partials/wpvr_documentation.php:115 | |
| 2145 | +#: legacy/admin/partials/wpvr_documentation.php:116 wpvr.php:426 | |
| 2146 | +msgid "Upgrade to Pro" | |
| 2147 | +msgstr "Uaktualnij do Pro" | |
| 2148 | + | |
| 2149 | +#: legacy/admin/partials/wpvr_license.php:18 | |
| 2150 | +msgid "License Key" | |
| 2151 | +msgstr "klucz licencyjny" | |
| 2152 | + | |
| 2153 | +#: legacy/admin/partials/wpvr_license.php:22 | |
| 2154 | +msgid "Enter your license key, save changes and activate." | |
| 2155 | +msgstr "Wprowadź klucz licencyjny, zapisz zmiany i aktywuj." | |
| 2156 | + | |
| 2157 | +#: legacy/admin/partials/wpvr_license.php:28 | |
| 2158 | +#: legacy/admin/partials/wpvr_license.php:38 | |
| 2159 | +msgid "Activate License" | |
| 2160 | +msgstr "Aktywuj licencję" | |
| 2161 | + | |
| 2162 | +#: legacy/admin/partials/wpvr_license.php:32 | |
| 2163 | +msgid "Active" | |
| 995 | 2164 | msgstr "" |
| 996 | 2165 | |
| 997 | -#: admin/partials/wpvr_documentation.php:458 | |
| 998 | -msgid "Partial Panorama / Mobile Panorama Support" | |
| 2166 | +#: legacy/admin/partials/wpvr_license.php:34 | |
| 2167 | +msgid "Deactivate License" | |
| 2168 | +msgstr "Dezaktywuj licencję" | |
| 2169 | + | |
| 2170 | +#: legacy/admin/partials/wpvr_setting.php:97 | |
| 2171 | +#: legacy/admin/partials/wpvr_setting.php:104 | |
| 2172 | +#, fuzzy | |
| 2173 | +msgid "General Settings" | |
| 2174 | +msgstr "Ogólne opcje konfiguracji" | |
| 2175 | + | |
| 2176 | +#: legacy/admin/partials/wpvr_setting.php:106 | |
| 2177 | +#, fuzzy | |
| 2178 | +msgid "Setup Options" | |
| 2179 | +msgstr "Ogólne opcje konfiguracji" | |
| 2180 | + | |
| 2181 | +#: legacy/admin/partials/wpvr_setting.php:131 | |
| 2182 | +msgid "" | |
| 2183 | +"Allow the Editors of your site to Create, Edit, Update, and Delete virtual " | |
| 2184 | +"tours (They can access other users' tours):" | |
| 999 | 2185 | msgstr "" |
| 2186 | +"Zezwól redaktorom Twojej witryny na tworzenie, edycję, aktualizację i " | |
| 2187 | +"usuwanie wirtualnych wycieczek (mogą uzyskać dostęp do wycieczek innych " | |
| 2188 | +"użytkowników):" | |
| 1000 | 2189 | |
| 1001 | -#: admin/classes/class-wpvr-meta-field.php:1606 | |
| 1002 | -msgid "Paste Youtube or Vimeo link or upload" | |
| 2190 | +#. translators: %s: documentation url | |
| 2191 | +#: legacy/admin/partials/wpvr_setting.php:159 | |
| 2192 | +#, php-format | |
| 2193 | +msgid "" | |
| 2194 | +"Enable editors to manage all virtual tours on your site, including those " | |
| 2195 | +"created by other users. <a href=\"%s\" target=\"_blank\" rel=\"noopener " | |
| 2196 | +"noreferrer\">View Doc</a>" | |
| 1003 | 2197 | msgstr "" |
| 1004 | 2198 | |
| 1005 | -#: admin/classes/class-wpvr-ajax.php:375 | |
| 1006 | -msgid "Permission check failed" | |
| 2199 | +#: legacy/admin/partials/wpvr_setting.php:174 | |
| 2200 | +msgid "" | |
| 2201 | +"Allow the Authors of your site to Create, Edit, Update, and Delete virtual " | |
| 2202 | +"tours (They can access their own tours only):" | |
| 1007 | 2203 | msgstr "" |
| 2204 | +"Zezwól autorom Twojej witryny na tworzenie, edycję, aktualizację i usuwanie " | |
| 2205 | +"wirtualnych wycieczek (mogą uzyskać dostęp tylko do własnych wycieczek):" | |
| 1008 | 2206 | |
| 1009 | -#: admin/partials/wpvr_setup_wizard.php:126 | |
| 1010 | -msgid "Personalize your virtual tours, in the way you want." | |
| 2207 | +#. translators: %s: documentation url | |
| 2208 | +#: legacy/admin/partials/wpvr_setting.php:201 | |
| 2209 | +#, php-format | |
| 2210 | +msgid "" | |
| 2211 | +"Grant authors permission to manage only their own virtual tours without " | |
| 2212 | +"accessing others' tours. <a href=\"%s\" target=\"_blank\" rel=\"noopener " | |
| 2213 | +"noreferrer\">View Doc</a>" | |
| 1011 | 2214 | msgstr "" |
| 1012 | 2215 | |
| 1013 | -#: admin/classes/class-wpvr-meta-field.php:964 | |
| 1014 | -msgid "Pitch" | |
| 2216 | +#: legacy/admin/partials/wpvr_setting.php:216 | |
| 2217 | +#, fuzzy | |
| 2218 | +msgid "" | |
| 2219 | +"Allow Dokan Vendors of your site to Create, Edit, Update, and Delete virtual " | |
| 2220 | +"tours (They can access their own tours only):" | |
| 1015 | 2221 | msgstr "" |
| 2222 | +"Zezwól autorom Twojej witryny na tworzenie, edycję, aktualizację i usuwanie " | |
| 2223 | +"wirtualnych wycieczek (mogą uzyskać dostęp tylko do własnych wycieczek):" | |
| 1016 | 2224 | |
| 1017 | -#: admin/classes/class-tour-guide-translation.php:58 | |
| 1018 | -#: admin/classes/class-tour-guide-translation.php:62 | |
| 1019 | -msgid "Pitch & Yaw is Set" | |
| 2225 | +#: legacy/admin/partials/wpvr_setting.php:238 | |
| 2226 | +#, fuzzy | |
| 2227 | +msgid "" | |
| 2228 | +"Dokan vendor will be able to Create, Edit, Update, and Delete their own " | |
| 2229 | +"virtual tours only." | |
| 1020 | 2230 | msgstr "" |
| 2231 | +"Autorzy będą mogli tworzyć, edytować, aktualizować i usuwać tylko własne " | |
| 2232 | +"wirtualne wycieczki." | |
| 1021 | 2233 | |
| 1022 | -#: admin/partials/wpvr_documentation.php:213 | |
| 1023 | -msgid "Post a Ticket" | |
| 1024 | -msgstr "Opublikuj bilet" | |
| 2234 | +#: legacy/admin/partials/wpvr_setting.php:246 | |
| 2235 | +msgid "Disable Fontawesome from WP VR:" | |
| 2236 | +msgstr "Wyłącz FontaWesome z WP VR:" | |
| 1025 | 2237 | |
| 1026 | -#: admin/partials/wpvr_setup_wizard.php:193 | |
| 1027 | -msgid "Premium Features" | |
| 2238 | +#. translators: %s: documentation url | |
| 2239 | +#: legacy/admin/partials/wpvr_setting.php:274 | |
| 2240 | +#, php-format | |
| 2241 | +msgid "" | |
| 2242 | +"Turn off the Fontawesome icon library in WP VR if you prefer to use custom " | |
| 2243 | +"icons or other icon libraries. <a href=\"%s\" target=\"_blank\" rel=" | |
| 2244 | +"\"noopener noreferrer\">View Doc</a>" | |
| 1028 | 2245 | msgstr "" |
| 1029 | 2246 | |
| 1030 | -#: admin/classes/class-tour-preview-meta-box.php:853 | |
| 1031 | -msgid "Preview" | |
| 2247 | +#: legacy/admin/partials/wpvr_setting.php:288 | |
| 2248 | +msgid "Enable mobile media resizer:" | |
| 2249 | +msgstr "Włącz zmianę rozmiaru nośników mobilnych:" | |
| 2250 | + | |
| 2251 | +#: legacy/admin/partials/wpvr_setting.php:310 | |
| 2252 | +msgid "" | |
| 2253 | +" Automatically adjust media sizes for mobile devices to ensure optimal " | |
| 2254 | +"viewing performance." | |
| 1032 | 2255 | msgstr "" |
| 1033 | 2256 | |
| 1034 | -#: admin/classes/class-wpvr-meta-field.php:146 | |
| 1035 | -msgid "Preview Image Message" | |
| 2257 | +#: legacy/admin/partials/wpvr_setting.php:316 | |
| 2258 | +msgid "Disable WordPress Large Image Handler on WP VR:" | |
| 2259 | +msgstr "Wyłącz duży program obsługi obrazów WordPress na WP VR:" | |
| 2260 | + | |
| 2261 | +#. translators: %s: documentation url | |
| 2262 | +#: legacy/admin/partials/wpvr_setting.php:344 | |
| 2263 | +#, php-format | |
| 2264 | +msgid "" | |
| 2265 | +"Prevent WordPress from resizing large images, keeping the original size for " | |
| 2266 | +"better quality in tours. <a href=\"%s\" target=\"_blank\" rel=\"noopener " | |
| 2267 | +"noreferrer\">View Doc</a>" | |
| 1036 | 2268 | msgstr "" |
| 1037 | 2269 | |
| 1038 | -#: admin/classes/class-tour-guide-translation.php:25 | |
| 1039 | -msgid "Preview The Image in Tour Mode" | |
| 2270 | +#: legacy/admin/partials/wpvr_setting.php:360 | |
| 2271 | +msgid "Disable On Hover Content for Mobile:" | |
| 2272 | +msgstr "Wyłącz zawartość najechania na telefon komórkowy:" | |
| 2273 | + | |
| 2274 | +#. translators: %s: documentation url | |
| 2275 | +#: legacy/admin/partials/wpvr_setting.php:388 | |
| 2276 | +#, php-format | |
| 2277 | +msgid "" | |
| 2278 | +"Turn off hover-based content interactions on mobile devices to enhance " | |
| 2279 | +"usability on touch screens. <a href=\"%s\" target=\"_blank\" rel=\"noopener " | |
| 2280 | +"noreferrer\">View Doc</a>" | |
| 1040 | 2281 | msgstr "" |
| 1041 | 2282 | |
| 1042 | -#: admin/classes/class-tour-guide-translation.php:74 | |
| 1043 | -msgid "Preview Your Hotspot Content" | |
| 2283 | +#: legacy/admin/partials/wpvr_setting.php:402 | |
| 2284 | +msgid "Enable Mobile Hotspot Tip:" | |
| 1044 | 2285 | msgstr "" |
| 1045 | 2286 | |
| 1046 | -#: admin/classes/class-tour-guide-translation.php:9 | |
| 1047 | -msgid "Previous" | |
| 2287 | +#: legacy/admin/partials/wpvr_setting.php:415 | |
| 2288 | +msgid "" | |
| 2289 | +"When enabled, a tip message is shown to mobile visitors after their first " | |
| 2290 | +"interaction with the virtual tour." | |
| 1048 | 2291 | msgstr "" |
| 1049 | 2292 | |
| 1050 | -#: admin/classes/class-wpvr-meta-field.php:432 | |
| 1051 | -#: admin/classes/class-wpvr-meta-field.php:466 | |
| 1052 | -msgid "Print the forms shortcode you want to show." | |
| 2293 | +#: legacy/admin/partials/wpvr_setting.php:421 | |
| 2294 | +msgid "" | |
| 2295 | +"Enable script control (It will load the WP VR scripts on the pages with " | |
| 2296 | +"virtual tours only):" | |
| 1053 | 2297 | msgstr "" |
| 2298 | +"Włącz kontrolę skryptów (załaduje skrypty WP VR na stronach tylko z " | |
| 2299 | +"wirtualnymi wycieczkami):" | |
| 1054 | 2300 | |
| 1055 | -#: admin/partials/wpvr_documentation.php:287 | |
| 1056 | -msgid "pro" | |
| 2301 | +#. translators: %s: documentation url | |
| 2302 | +#: legacy/admin/partials/wpvr_setting.php:449 | |
| 2303 | +#, php-format | |
| 2304 | +msgid "" | |
| 2305 | +"Load WP VR scripts only on pages with virtual tours, improving page load " | |
| 2306 | +"times on other pages. <a href=\"%s\" target=\"_blank\" rel=\"noopener " | |
| 2307 | +"noreferrer\">View Doc</a>" | |
| 1057 | 2308 | msgstr "" |
| 1058 | 2309 | |
| 1059 | -#: admin/partials/wpvr_documentation.php:319 | |
| 1060 | -msgid "Publish Tours Anywhere (Embed Add-on)" | |
| 2310 | +#: legacy/admin/partials/wpvr_setting.php:463 | |
| 2311 | +msgid "" | |
| 2312 | +"List of allowed pages to load WP VR scripts (The URLs of the pages on your " | |
| 2313 | +"site with virtual tours):" | |
| 1061 | 2314 | msgstr "" |
| 2315 | +"Lista dozwolonych stron do załadowania skryptów WP VR (adresy URL stron w " | |
| 2316 | +"Twojej witrynie z wirtualnymi wycieczkami):" | |
| 1062 | 2317 | |
| 1063 | -#: admin/classes/class-tour-guide-translation.php:37 | |
| 1064 | -msgid "Publish Your Tour" | |
| 2318 | +#: legacy/admin/partials/wpvr_setting.php:468 | |
| 2319 | +msgid "" | |
| 2320 | +"List the pages with virtual tours like this: https://example.com/tour1/, " | |
| 2321 | +"https://example.com/tour2/" | |
| 1065 | 2322 | msgstr "" |
| 2323 | +"Wymień strony z wirtualnymi wycieczkami w następujący sposób: https://" | |
| 2324 | +"example.com/tour1/, https://example.com/tour2/" | |
| 1066 | 2325 | |
| 1067 | -#: elementor/elements/Wpvr-widget.php:178 | |
| 1068 | -msgid "Put value in (px)" | |
| 1069 | -msgstr "Wpisz wartość w (px)" | |
| 2326 | +#: legacy/admin/partials/wpvr_setting.php:475 | |
| 2327 | +#, fuzzy | |
| 2328 | +msgid "" | |
| 2329 | +"Video Tour JS control (It will load the WP VR Video JS library in the listed " | |
| 2330 | +"pages only):" | |
| 2331 | +msgstr "" | |
| 2332 | +"Włącz kontrolę wideo JS (załaduje bibliotekę WP VR Video JS tylko na " | |
| 2333 | +"wymienionych stronach):" | |
| 1070 | 2334 | |
| 1071 | -#: oxygen/elements/Wpvr_Tour_Element.php:56 | |
| 1072 | -#: oxygen/elements/Wpvr_Tour_Element.php:76 | |
| 1073 | -#: oxygen/elements/Wpvr_Tour_Element.php:106 | |
| 1074 | -#: oxygen/elements/Wpvr_Tour_Element.php:123 | |
| 1075 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:118 | |
| 1076 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:159 | |
| 1077 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:182 | |
| 1078 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:204 | |
| 1079 | -msgid "px" | |
| 2335 | +#. translators: %s: documentation url | |
| 2336 | +#: legacy/admin/partials/wpvr_setting.php:503 | |
| 2337 | +#, php-format | |
| 2338 | +msgid "" | |
| 2339 | +"Activate the Video.js library only on pages that contain virtual video " | |
| 2340 | +"tours, optimizing resources. <a href=\"%s\" target=\"_blank\" rel=\"noopener " | |
| 2341 | +"noreferrer\">View Doc</a>" | |
| 1080 | 2342 | msgstr "" |
| 1081 | 2343 | |
| 1082 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:170 | |
| 1083 | -msgid "Radius" | |
| 2344 | +#: legacy/admin/partials/wpvr_setting.php:517 | |
| 2345 | +msgid "" | |
| 2346 | +"List of allowed pages to load WP VR Video JS library (The URLs of the pages " | |
| 2347 | +"on your site, You want to load Video JS):" | |
| 1084 | 2348 | msgstr "" |
| 2349 | +"Lista dozwolonych stron do załadowania biblioteki WP VR Video JS (adresy URL " | |
| 2350 | +"stron w Twojej witrynie, chcesz załadować wideo JS):" | |
| 1085 | 2351 | |
| 1086 | -#: oxygen/elements/Wpvr_Tour_Element.php:101 | |
| 1087 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:178 | |
| 1088 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:179 | |
| 1089 | -msgid "Radius Unit" | |
| 2352 | +#: legacy/admin/partials/wpvr_setting.php:522 | |
| 2353 | +msgid "" | |
| 2354 | +"List the pages like this: https://example.com/tour1/, https://example.com/" | |
| 2355 | +"tour2/" | |
| 1090 | 2356 | msgstr "" |
| 2357 | +"Wymień strony w następujący sposób: https://example.com/tour1/, https://" | |
| 2358 | +"example.com/tour2/" | |
| 1091 | 2359 | |
| 1092 | -#: elementor/elements/Wpvr-widget.php:185 | |
| 1093 | -msgid "Radius:" | |
| 1094 | -msgstr "Promień:" | |
| 2360 | +#: legacy/admin/partials/wpvr_setting.php:535 | |
| 2361 | +msgid "Flip the phone to landscape mode for a better experience of the tour." | |
| 2362 | +msgstr "Przesuń telefon w tryb poziomy, aby uzyskać lepsze wrażenia z trasy." | |
| 1095 | 2363 | |
| 1096 | -#: admin/partials/wpvr_documentation.php:222 | |
| 1097 | -#, fuzzy | |
| 1098 | -#| msgid "Rate Us! " | |
| 1099 | -msgid "Rate Us " | |
| 1100 | -msgstr "Oceń nas!" | |
| 2364 | +#: legacy/admin/partials/wpvr_setting.php:539 | |
| 2365 | +msgid "Front-End Notice for Mobile Visitors:" | |
| 2366 | +msgstr "Powiadomienie z front-end dla użytkowników mobilnych:" | |
| 1101 | 2367 | |
| 1102 | -#: admin/partials/wpvr_setup_wizard.php:218 | |
| 1103 | -msgid "Read Documentations" | |
| 2368 | +#: legacy/admin/partials/wpvr_setting.php:561 | |
| 2369 | +msgid "" | |
| 2370 | +"Display a message on the front end to inform mobile visitors about virtual " | |
| 2371 | +"tour capabilities or requirements." | |
| 1104 | 2372 | msgstr "" |
| 1105 | 2373 | |
| 1106 | -#: admin/partials/wpvr_setup_wizard.php:219 | |
| 1107 | -msgid "Read Our Complete Guides" | |
| 1108 | -msgstr "" | |
| 2374 | +#: legacy/admin/partials/wpvr_setting.php:569 | |
| 2375 | +msgid "VR GLass Support:" | |
| 2376 | +msgstr "Wsparcie szkła VR:" | |
| 1109 | 2377 | |
| 1110 | -#: admin/partials/wpvr_documentation.php:244 | |
| 2378 | +#. translators: %s: documentation url | |
| 2379 | +#: legacy/admin/partials/wpvr_setting.php:607 | |
| 2380 | +#, php-format | |
| 1111 | 2381 | msgid "" |
| 1112 | -"Recover abandoned carts with automated email drip campaigns. Start getting " | |
| 1113 | -"back lost sales on your online store." | |
| 2382 | +"Enable compatibility with VR glasses for immersive viewing of virtual tours " | |
| 2383 | +"on supported devices. <a href=\"%s\" target=\"_blank\" rel=\"noopener " | |
| 2384 | +"noreferrer\">View Doc</a>" | |
| 1114 | 2385 | msgstr "" |
| 1115 | 2386 | |
| 1116 | -#: admin/classes/class-wpvr-meta-field.php:403 | |
| 1117 | -msgid "Resume Auto-rotation after" | |
| 2387 | +#: legacy/admin/partials/wpvr_setting.php:621 | |
| 2388 | +#, fuzzy | |
| 2389 | +msgid "Convert any jpeg or png format image to WebP on media upload:" | |
| 1118 | 2390 | msgstr "" |
| 2391 | +"Konwertuj dowolny obraz w formacie JPEG lub PNG na WebP podczas przesyłania " | |
| 2392 | +"multimediów:" | |
| 1119 | 2393 | |
| 1120 | -#. Author of the plugin | |
| 1121 | -msgid "Rextheme" | |
| 1122 | -msgstr "Rextheme" | |
| 2394 | +#: legacy/admin/partials/wpvr_setting.php:657 | |
| 2395 | +msgid "" | |
| 2396 | +"Automatically convert JPEG or PNG images to the WebP format when uploading, " | |
| 2397 | +"improving load times and image quality." | |
| 2398 | +msgstr "" | |
| 1123 | 2399 | |
| 1124 | -#: admin/classes/class-wpvr-meta-field.php:3087 | |
| 1125 | -#: admin/classes/class-wpvr-meta-field.php:3151 | |
| 1126 | -msgid "Right" | |
| 2400 | +#: legacy/admin/partials/wpvr_setting.php:666 | |
| 2401 | +msgid "Allow Usage Data Sharing:" | |
| 1127 | 2402 | msgstr "" |
| 1128 | 2403 | |
| 1129 | -#: admin/classes/class-wpvr-meta-field.php:394 | |
| 1130 | -msgid "Rotation Speed and Direction" | |
| 2404 | +#: legacy/admin/partials/wpvr_setting.php:678 | |
| 2405 | +msgid "" | |
| 2406 | +"Share your site URL, email, and anonymous usage data to help us improve WP " | |
| 2407 | +"VR. You can disable this at any time." | |
| 1131 | 2408 | msgstr "" |
| 1132 | 2409 | |
| 1133 | -#: admin/partials/wpvr_documentation.php:1156 | |
| 1134 | -msgid "Save" | |
| 2410 | +#: legacy/admin/partials/wpvr_setting.php:686 | |
| 2411 | +msgid "Select a Version to Rollback" | |
| 2412 | +msgstr "Wybierz wersję do wycofania" | |
| 2413 | + | |
| 2414 | +#: legacy/admin/partials/wpvr_setting.php:708 | |
| 2415 | +msgid "Succesfully Saved" | |
| 1135 | 2416 | msgstr "" |
| 1136 | 2417 | |
| 1137 | -#: admin/classes/class-tour-guide-translation.php:78 | |
| 1138 | -msgid "Save Your Progress" | |
| 2418 | +#: legacy/admin/partials/wpvr_setting.php:712 | |
| 2419 | +#, fuzzy | |
| 2420 | +msgid "Reset Defaults" | |
| 2421 | +msgstr "Ustaw jako domyślny" | |
| 2422 | + | |
| 2423 | +#: legacy/admin/partials/wpvr_setting.php:716 | |
| 2424 | +#, fuzzy | |
| 2425 | +msgid "Save Settings" | |
| 2426 | +msgstr "Ustawienie sceny" | |
| 2427 | + | |
| 2428 | +#: legacy/bricks/bricks.php:65 legacy/bricks/Wpvr-widget.php:76 | |
| 2429 | +#: legacy/bricks/Wpvr-widget.php:90 legacy/bricks/Wpvr-widget.php:96 | |
| 2430 | +#: legacy/builders/wpbakery/wpvr-element.php:44 | |
| 2431 | +#: legacy/elementor/elements/Wpvr-widget.php:43 | |
| 2432 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:60 | |
| 2433 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:66 | |
| 2434 | +msgid "WPVR" | |
| 2435 | +msgstr "WPVR" | |
| 2436 | + | |
| 2437 | +#: legacy/bricks/Wpvr-widget.php:130 | |
| 2438 | +#: legacy/builders/wpbakery/wpvr-element.php:53 | |
| 2439 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:128 | |
| 2440 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:51 legacy/src/index.js:134 | |
| 2441 | +#, fuzzy | |
| 2442 | +msgid "Select Tour" | |
| 2443 | +msgstr "Wybierz swój formularz" | |
| 2444 | + | |
| 2445 | +#: legacy/bricks/Wpvr-widget.php:140 | |
| 2446 | +#, fuzzy | |
| 2447 | +msgid "Width(px)" | |
| 2448 | +msgstr "Szerokość (Px)" | |
| 2449 | + | |
| 2450 | +#: legacy/bricks/Wpvr-widget.php:144 | |
| 2451 | +#, fuzzy | |
| 2452 | +msgid "Height(px)" | |
| 2453 | +msgstr "zenit" | |
| 2454 | + | |
| 2455 | +#: legacy/bricks/Wpvr-widget.php:148 | |
| 2456 | +#, fuzzy | |
| 2457 | +msgid "Radius(px)" | |
| 2458 | +msgstr "promień" | |
| 2459 | + | |
| 2460 | +#: legacy/bricks/Wpvr-widget.php:194 | |
| 2461 | +msgid "No tour has been selected." | |
| 1139 | 2462 | msgstr "" |
| 1140 | 2463 | |
| 1141 | -#: admin/classes/class-tour-guide-translation.php:33 | |
| 1142 | -msgid "Save Your Tour" | |
| 2464 | +#: legacy/builders/wpbakery/wpvr-element.php:26 | |
| 2465 | +#, fuzzy | |
| 2466 | +msgid "Select a tour" | |
| 2467 | +msgstr "Wybierz swój formularz" | |
| 2468 | + | |
| 2469 | +#: legacy/builders/wpbakery/wpvr-element.php:42 | |
| 2470 | +#, fuzzy | |
| 2471 | +msgid "WPVR - Virtual Tour" | |
| 2472 | +msgstr "Wirtualne wycieczki na całej stronie" | |
| 2473 | + | |
| 2474 | +#: legacy/builders/wpbakery/wpvr-element.php:46 | |
| 2475 | +msgid "Embed a WPVR virtual tour with full analytics and tracking support." | |
| 1143 | 2476 | msgstr "" |
| 1144 | 2477 | |
| 1145 | -#: admin/partials/wpvr_documentation.php:706 | |
| 1146 | -msgid "Scene Author with URL" | |
| 2478 | +#: legacy/builders/wpbakery/wpvr-element.php:62 | |
| 2479 | +msgid "Width (number only)" | |
| 1147 | 2480 | msgstr "" |
| 1148 | 2481 | |
| 1149 | -#: admin/classes/class-wpvr-meta-field.php:209 | |
| 1150 | -msgid "Scene Fade Duration" | |
| 2482 | +#: legacy/builders/wpbakery/wpvr-element.php:70 | |
| 2483 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:152 | |
| 2484 | +msgid "Width Unit" | |
| 2485 | +msgstr "Szerokość Jednostka" | |
| 2486 | + | |
| 2487 | +#: legacy/builders/wpbakery/wpvr-element.php:84 | |
| 2488 | +msgid "Height (number only)" | |
| 1151 | 2489 | msgstr "" |
| 1152 | 2490 | |
| 1153 | -#: admin/classes/class-wpvr-meta-field.php:709 | |
| 1154 | -msgid "Scene Gallery" | |
| 2491 | +#: legacy/builders/wpbakery/wpvr-element.php:92 | |
| 2492 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:193 | |
| 2493 | +msgid "Height Unit" | |
| 2494 | +msgstr "Wysokość" | |
| 2495 | + | |
| 2496 | +#: legacy/builders/wpbakery/wpvr-element.php:104 | |
| 2497 | +#, fuzzy | |
| 2498 | +msgid "Mobile Height (number only)" | |
| 2499 | +msgstr "Mobilna jednostka wysokości" | |
| 2500 | + | |
| 2501 | +#: legacy/builders/wpbakery/wpvr-element.php:112 | |
| 2502 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:215 | |
| 2503 | +msgid "Mobile Height Unit" | |
| 2504 | +msgstr "Mobilna jednostka wysokości" | |
| 2505 | + | |
| 2506 | +#: legacy/elementor/elements/Wpvr-widget.php:145 | |
| 2507 | +msgid "WPVR Setup" | |
| 2508 | +msgstr "Konfiguracja WPVR" | |
| 2509 | + | |
| 2510 | +#: legacy/elementor/elements/Wpvr-widget.php:156 | |
| 2511 | +#, fuzzy | |
| 2512 | +msgid "Select Tour:" | |
| 2513 | +msgstr "Wybierz swój formularz" | |
| 2514 | + | |
| 2515 | +#: legacy/elementor/elements/Wpvr-widget.php:165 | |
| 2516 | +msgid "Width:" | |
| 2517 | +msgstr "Szerokość:" | |
| 2518 | + | |
| 2519 | +#: legacy/elementor/elements/Wpvr-widget.php:168 | |
| 2520 | +#: legacy/elementor/elements/Wpvr-widget.php:178 | |
| 2521 | +#: legacy/elementor/elements/Wpvr-widget.php:188 | |
| 2522 | +#: legacy/elementor/elements/Wpvr-widget.php:197 | |
| 2523 | +#, fuzzy | |
| 2524 | +msgid "Put value in PX" | |
| 2525 | +msgstr "Wpisz wartość w (px)" | |
| 2526 | + | |
| 2527 | +#: legacy/elementor/elements/Wpvr-widget.php:175 | |
| 2528 | +msgid "Height:" | |
| 2529 | +msgstr "Wysokość:" | |
| 2530 | + | |
| 2531 | +#: legacy/elementor/elements/Wpvr-widget.php:185 | |
| 2532 | +msgid "Radius:" | |
| 2533 | +msgstr "Promień:" | |
| 2534 | + | |
| 2535 | +#: legacy/elementor/elements/Wpvr-widget.php:195 legacy/src/index.js:240 | |
| 2536 | +msgid "Mobile Height" | |
| 2537 | +msgstr "Wysokość mobilna" | |
| 2538 | + | |
| 2539 | +#: legacy/includes/class-wpvr-linno-telemetry.php:480 | |
| 2540 | +msgid "Setup / Interface is too complex" | |
| 1155 | 2541 | msgstr "" |
| 1156 | 2542 | |
| 1157 | -#: admin/classes/class-wpvr-meta-field.php:873 | |
| 1158 | -#: admin/classes/class-wpvr-meta-field.php:921 | |
| 1159 | -msgid "Scene ID" | |
| 2543 | +#: legacy/includes/class-wpvr-linno-telemetry.php:481 | |
| 2544 | +msgid "What was the biggest blocker?" | |
| 1160 | 2545 | msgstr "" |
| 1161 | 2546 | |
| 1162 | -#: admin/classes/class-wpvr-meta-field.php:725 | |
| 1163 | -msgid "Scene Navigation Menu" | |
| 2547 | +#: legacy/includes/class-wpvr-linno-telemetry.php:486 | |
| 2548 | +msgid "Missing specific VR feature" | |
| 1164 | 2549 | msgstr "" |
| 1165 | 2550 | |
| 1166 | -#: admin/classes/class-wpvr-scene.php:233 | |
| 1167 | -#: admin/classes/class-wpvr-scene.php:262 | |
| 1168 | -msgid "Scene Setting" | |
| 2551 | +#: legacy/includes/class-wpvr-linno-telemetry.php:487 | |
| 2552 | +msgid "Which feature? (Floor Plan, WebVR, etc.)" | |
| 1169 | 2553 | msgstr "" |
| 1170 | 2554 | |
| 1171 | -#: admin/partials/wpvr_documentation.php:702 | |
| 1172 | -msgid "Scene Title" | |
| 2555 | +#: legacy/includes/class-wpvr-linno-telemetry.php:492 | |
| 2556 | +msgid "Tour not displaying / Error" | |
| 1173 | 2557 | msgstr "" |
| 1174 | 2558 | |
| 1175 | -#: admin/classes/class-wpvr-meta-field.php:717 | |
| 1176 | -msgid "Scene Titles on Gallery" | |
| 2559 | +#: legacy/includes/class-wpvr-linno-telemetry.php:493 | |
| 2560 | +msgid "Any error message or URL?" | |
| 1177 | 2561 | msgstr "" |
| 1178 | 2562 | |
| 1179 | -#: admin/partials/wpvr_documentation.php:734 | |
| 1180 | -msgid "Scene Titles on Gallery." | |
| 2563 | +#: legacy/includes/class-wpvr-linno-telemetry.php:498 | |
| 2564 | +msgid "Image quality / Performance issues" | |
| 1181 | 2565 | msgstr "" |
| 1182 | 2566 | |
| 1183 | -#: admin/classes/class-wpvr-meta-field.php:881 | |
| 1184 | -#: admin/classes/class-wpvr-meta-field.php:929 | |
| 1185 | -msgid "Scene Type" | |
| 2567 | +#: legacy/includes/class-wpvr-linno-telemetry.php:499 | |
| 2568 | +msgid "Image size or browser details help." | |
| 1186 | 2569 | msgstr "" |
| 1187 | 2570 | |
| 1188 | -#: admin/classes/class-wpvr-meta-field.php:888 | |
| 1189 | -#: admin/classes/class-wpvr-meta-field.php:936 | |
| 1190 | -msgid "Scene Upload" | |
| 2571 | +#: legacy/includes/class-wpvr-linno-telemetry.php:504 | |
| 2572 | +msgid "Found a better solution" | |
| 1191 | 2573 | msgstr "" |
| 1192 | 2574 | |
| 1193 | -#: admin/partials/wpvr_documentation.php:416 | |
| 1194 | -msgid "Scene-type Hotspots (Connect Panoramas)" | |
| 2575 | +#: legacy/includes/class-wpvr-linno-telemetry.php:505 | |
| 2576 | +msgid "Which tool? What did it do better?" | |
| 1195 | 2577 | msgstr "" |
| 1196 | 2578 | |
| 1197 | -#: admin/classes/class-wpvr-meta-field.php:88 | |
| 1198 | -msgid "Scenes" | |
| 2579 | +#: legacy/includes/class-wpvr-linno-telemetry.php:510 | |
| 2580 | +msgid "Just testing / One-time project" | |
| 1199 | 2581 | msgstr "" |
| 1200 | 2582 | |
| 1201 | -#: admin/partials/wpvr_documentation.php:1134 | |
| 1202 | -msgid "Select a Version to Rollback" | |
| 2583 | +#: legacy/includes/class-wpvr-linno-telemetry.php:511 | |
| 2584 | +msgid "What were you building?" | |
| 1203 | 2585 | msgstr "" |
| 1204 | 2586 | |
| 1205 | -#: admin/classes/class-wpvr-meta-field.php:1025 | |
| 1206 | -#: admin/classes/class-wpvr-meta-field.php:1085 | |
| 1207 | -#: admin/classes/class-wpvr-meta-field.php:1152 | |
| 1208 | -#: admin/classes/class-wpvr-meta-field.php:1218 | |
| 1209 | -#: admin/classes/class-wpvr-meta-field.php:1277 | |
| 1210 | -msgid "Select Target Scene from List" | |
| 2587 | +#: legacy/includes/class-wpvr.php:246 | |
| 2588 | +#, fuzzy | |
| 2589 | +msgid "Floor Plan Settings : " | |
| 2590 | +msgstr "Ustawienia wideo:" | |
| 2591 | + | |
| 2592 | +#: legacy/includes/class-wpvr.php:253 | |
| 2593 | +msgid "Enable Floor Plan: " | |
| 1211 | 2594 | msgstr "" |
| 1212 | 2595 | |
| 1213 | -#: admin/classes/class-wpvr-meta-field.php:1120 | |
| 1214 | -#: admin/classes/class-wpvr-meta-field.php:1186 | |
| 1215 | -msgid "Select your form" | |
| 2596 | +#. translators: %s: documentation url | |
| 2597 | +#: legacy/includes/class-wpvr.php:268 | |
| 2598 | +#, php-format | |
| 2599 | +msgid "" | |
| 2600 | +"Activate the floor plan view for your virtual tour. <a href=\"%s\" target=" | |
| 2601 | +"\"_blank\" rel=\"noopener noreferrer\">View Doc</a>" | |
| 1216 | 2602 | msgstr "" |
| 1217 | 2603 | |
| 1218 | -#: admin/partials/wpvr_setup_wizard.php:141 | |
| 1219 | -msgid "Sell WooCommerce Products" | |
| 1220 | -msgstr "" | |
| 2604 | +#: legacy/includes/class-wpvr.php:296 | |
| 2605 | +#, fuzzy | |
| 2606 | +msgid "Background Tour Settings : " | |
| 2607 | +msgstr "Ustawienia wideo:" | |
| 1221 | 2608 | |
| 1222 | -#: admin/classes/class-wpvr-meta-field.php:417 | |
| 2609 | +#: legacy/includes/class-wpvr.php:302 | |
| 2610 | +#, fuzzy | |
| 2611 | +msgid "Enable Background Tour: " | |
| 2612 | +msgstr "Kolor tła" | |
| 2613 | + | |
| 2614 | +#. translators: %s: documentation url | |
| 2615 | +#: legacy/includes/class-wpvr.php:317 | |
| 2616 | +#, php-format | |
| 1223 | 2617 | msgid "" |
| 1224 | -"Set a time after which auto rotation will stop. Assign in milliseconds, " | |
| 1225 | -"where 1000 milliseconds = 1 second." | |
| 2618 | +"When enabled, a title and subtitle will appear at the top of the tour. <a " | |
| 2619 | +"href=\"%s\" target=\"_blank\" rel=\"noopener noreferrer\">View Doc</a>" | |
| 1226 | 2620 | msgstr "" |
| 1227 | 2621 | |
| 1228 | -#: admin/classes/class-tour-guide-translation.php:12 | |
| 1229 | -msgid "Set a Title to Your Virtual Tour" | |
| 2622 | +#: legacy/includes/class-wpvr.php:343 | |
| 2623 | +#, fuzzy | |
| 2624 | +msgid "Embed Google Street View : " | |
| 2625 | +msgstr "Widok ulicy Google" | |
| 2626 | + | |
| 2627 | +#: legacy/includes/class-wpvr.php:347 | |
| 2628 | +#, fuzzy | |
| 2629 | +msgid "Enable Street View:" | |
| 2630 | +msgstr "Widok ulicy Google" | |
| 2631 | + | |
| 2632 | +#: legacy/includes/class-wpvr.php:352 | |
| 2633 | +msgid "Insert a Street View iframe link." | |
| 1230 | 2634 | msgstr "" |
| 1231 | 2635 | |
| 1232 | -#: admin/classes/class-wpvr-meta-field.php:140 | |
| 1233 | -msgid "Set a Tour Preview Image" | |
| 2636 | +#: legacy/includes/class-wpvr.php:388 | |
| 2637 | +#, fuzzy | |
| 2638 | +msgid "Export Tour : " | |
| 2639 | +msgstr "Importuj plik wycieczki:" | |
| 2640 | + | |
| 2641 | +#: legacy/includes/class-wpvr.php:389 | |
| 2642 | +#, fuzzy | |
| 2643 | +msgid "Download" | |
| 2644 | +msgstr "pobierz kod QR" | |
| 2645 | + | |
| 2646 | +#: legacy/includes/setup-wizard.php:109 | |
| 2647 | +msgid "Limit Reached" | |
| 1234 | 2648 | msgstr "" |
| 1235 | 2649 | |
| 1236 | -#: admin/classes/class-wpvr-meta-field.php:399 | |
| 1237 | -msgid "" | |
| 1238 | -"Set a value to determine the speed of rotation. The higher the number, the " | |
| 1239 | -"faster it will rotate. Positive values will make it rotate clockwise and " | |
| 1240 | -"negative values will make it rotate anti clockwise" | |
| 2650 | +#. translators: %d: maximum number of hotspots allowed in free version | |
| 2651 | +#: legacy/includes/setup-wizard.php:111 | |
| 2652 | +#, php-format | |
| 2653 | +msgid "You can add up to %d hotspots on each scene in the Free version." | |
| 1241 | 2654 | msgstr "" |
| 1242 | 2655 | |
| 1243 | -#: admin/classes/class-tour-guide-translation.php:47 | |
| 1244 | -msgid "" | |
| 1245 | -"Set an unique Hotspot ID to each of your Hotspots. Avoid Spaces & special " | |
| 1246 | -"characters. Set it like H1 or 01" | |
| 2656 | +#: legacy/includes/setup-wizard.php:112 | |
| 2657 | +msgid "Upgrade to Pro to add an unlimited number of hotspots." | |
| 1247 | 2658 | msgstr "" |
| 1248 | 2659 | |
| 1249 | -#: admin/classes/class-wpvr-meta-field.php:866 | |
| 1250 | -#: admin/classes/class-wpvr-meta-field.php:914 | |
| 1251 | -msgid "Set as Default" | |
| 2660 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:129 | |
| 2661 | +msgid "WPVR Tour ID" | |
| 2662 | +msgstr "Identyfikator trasy WPVR" | |
| 2663 | + | |
| 2664 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:140 | |
| 2665 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:59 legacy/src/index.js:141 | |
| 2666 | +#, fuzzy | |
| 2667 | +msgid "Tour Width" | |
| 2668 | +msgstr "szerokość" | |
| 2669 | + | |
| 2670 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:141 | |
| 2671 | +msgid "WPVR Width" | |
| 2672 | +msgstr "Szerokość WPVR" | |
| 2673 | + | |
| 2674 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:151 | |
| 2675 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:67 | |
| 2676 | +#, fuzzy | |
| 2677 | +msgid "Tour Width Unit" | |
| 2678 | +msgstr "Szerokość Jednostka" | |
| 2679 | + | |
| 2680 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:155 | |
| 2681 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:196 | |
| 2682 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:218 | |
| 2683 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:240 | |
| 2684 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:71 | |
| 2685 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:103 | |
| 2686 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:122 | |
| 2687 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:141 | |
| 2688 | +msgid "px" | |
| 2689 | +msgstr "ermodrale" | |
| 2690 | + | |
| 2691 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:156 | |
| 2692 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:72 | |
| 2693 | +msgid "%" | |
| 2694 | +msgstr "prokuratura" | |
| 2695 | + | |
| 2696 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:157 | |
| 2697 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:73 | |
| 2698 | +msgid "vw" | |
| 2699 | +msgstr "VW" | |
| 2700 | + | |
| 2701 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:169 | |
| 2702 | +#, fuzzy | |
| 2703 | +msgid "Tour Fullwidth" | |
| 2704 | +msgstr "pełna szerokość" | |
| 2705 | + | |
| 2706 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:170 | |
| 2707 | +#: legacy/src/index.js:53 | |
| 2708 | +msgid "Fullwidth" | |
| 2709 | +msgstr "pełna szerokość" | |
| 2710 | + | |
| 2711 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:184 | |
| 2712 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:92 legacy/src/index.js:157 | |
| 2713 | +#, fuzzy | |
| 2714 | +msgid "Tour Height" | |
| 2715 | +msgstr "zenit" | |
| 2716 | + | |
| 2717 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:185 | |
| 2718 | +msgid "WPVR Height" | |
| 2719 | +msgstr "Wysokość WPVR" | |
| 2720 | + | |
| 2721 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:192 | |
| 2722 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:99 | |
| 2723 | +#, fuzzy | |
| 2724 | +msgid "Tour Height Unit" | |
| 2725 | +msgstr "Wysokość" | |
| 2726 | + | |
| 2727 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:197 | |
| 2728 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:104 | |
| 2729 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:123 | |
| 2730 | +msgid "vh" | |
| 2731 | +msgstr "ves" | |
| 2732 | + | |
| 2733 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:206 | |
| 2734 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:111 legacy/src/index.js:172 | |
| 2735 | +#, fuzzy | |
| 2736 | +msgid "Tour Mobile Height" | |
| 2737 | +msgstr "Wysokość mobilna" | |
| 2738 | + | |
| 2739 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:207 | |
| 2740 | +msgid "WPVR Mobile Height" | |
| 2741 | +msgstr "Wysokość mobilna WPVR" | |
| 2742 | + | |
| 2743 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:214 | |
| 2744 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:118 | |
| 2745 | +#, fuzzy | |
| 2746 | +msgid "Tour Mobile Height Unit" | |
| 2747 | +msgstr "Mobilna jednostka wysokości" | |
| 2748 | + | |
| 2749 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:228 | |
| 2750 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:130 | |
| 2751 | +#, fuzzy | |
| 2752 | +msgid "Tour Radius" | |
| 2753 | +msgstr "promień" | |
| 2754 | + | |
| 2755 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:229 | |
| 2756 | +msgid "WPVR Radius" | |
| 2757 | +msgstr "Promień WPVR" | |
| 2758 | + | |
| 2759 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:236 | |
| 2760 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:137 | |
| 2761 | +#, fuzzy | |
| 2762 | +msgid "Tour Radius Unit" | |
| 2763 | +msgstr "Jednostka promienia" | |
| 2764 | + | |
| 2765 | +#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:237 | |
| 2766 | +msgid "Radius Unit" | |
| 2767 | +msgstr "Jednostka promienia" | |
| 2768 | + | |
| 2769 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:22 | |
| 2770 | +#, fuzzy | |
| 2771 | +msgid "WP VR Tour" | |
| 2772 | +msgstr "Identyfikator trasy WPVR" | |
| 2773 | + | |
| 2774 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:44 | |
| 2775 | +msgid "No title" | |
| 1252 | 2776 | msgstr "" |
| 1253 | 2777 | |
| 1254 | -#: admin/partials/wpvr_setup_wizard.php:162 | |
| 1255 | -msgid "Set Contact Form" | |
| 2778 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:80 | |
| 2779 | +#, fuzzy | |
| 2780 | +msgid "Tour Width Fullwidth" | |
| 2781 | +msgstr "szerokość pełna szerokość" | |
| 2782 | + | |
| 2783 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:84 | |
| 2784 | +msgid "OFF" | |
| 2785 | +msgstr "opodal" | |
| 2786 | + | |
| 2787 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:85 | |
| 2788 | +msgid "ON" | |
| 2789 | +msgstr "przez" | |
| 2790 | + | |
| 2791 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:114 | |
| 2792 | +msgid "Height on mobile devices. Leave empty to use the main height." | |
| 1256 | 2793 | msgstr "" |
| 1257 | 2794 | |
| 1258 | -#: admin/classes/class-tour-guide-translation.php:46 | |
| 1259 | -msgid "Set Hotspot ID" | |
| 2795 | +#: legacy/oxygen/elements/Wpvr_Tour_Element.php:159 | |
| 2796 | +msgid "Please select a WP VR Tour from the dropdown in the sidebar." | |
| 1260 | 2797 | msgstr "" |
| 1261 | 2798 | |
| 1262 | -#: admin/classes/class-tour-guide-translation.php:66 | |
| 1263 | -#: admin/classes/class-tour-guide-translation.php:70 | |
| 1264 | -msgid "Set The Content for Click Action" | |
| 2799 | +#: legacy/oxygen/WPVR_OXY_INTEGRATION.php:32 | |
| 2800 | +msgid "Build with WP VR" | |
| 1265 | 2801 | msgstr "" |
| 1266 | 2802 | |
| 1267 | -#: admin/classes/class-tour-guide-translation.php:17 | |
| 2803 | +#: legacy/public/class-wpvr-public.php:200 | |
| 2804 | +#, fuzzy | |
| 2805 | +msgid "Virtual tour" | |
| 2806 | +msgstr "Wirtualne wycieczki na całej stronie" | |
| 2807 | + | |
| 2808 | +#: legacy/public/class-wpvr-public.php:201 | |
| 1268 | 2809 | msgid "" |
| 1269 | -"Set the Scene ID for your first panorama image. The Scene ID has to be " | |
| 1270 | -"unique for each scene and without any spaces or special characters. You can " | |
| 1271 | -"set it as Scene1, S1, or simply 01." | |
| 2810 | +"Use the arrow keys or W, A, S, and D to look around. Use Tab to reach tour " | |
| 2811 | +"controls and hotspots." | |
| 1272 | 2812 | msgstr "" |
| 1273 | 2813 | |
| 1274 | -#: admin/classes/class-wpvr-meta-field.php:749 | |
| 1275 | -msgid "Set Zoom Preferences" | |
| 2814 | +#: legacy/public/class-wpvr-public.php:202 | |
| 2815 | +#, fuzzy | |
| 2816 | +msgid "Load virtual tour" | |
| 2817 | +msgstr "dla nieograniczonej wirtualnej wycieczki." | |
| 2818 | + | |
| 2819 | +#: legacy/public/class-wpvr-public.php:203 | |
| 2820 | +#, fuzzy | |
| 2821 | +msgid "Tour hotspot" | |
| 2822 | +msgstr "gorący miejsce" | |
| 2823 | + | |
| 2824 | +#: legacy/public/class-wpvr-public.php:204 | |
| 2825 | +msgid "View scene" | |
| 1276 | 2826 | msgstr "" |
| 1277 | 2827 | |
| 1278 | -#: admin/partials/wpvr_documentation.php:150 | |
| 1279 | -msgid "Settings" | |
| 2828 | +#: legacy/public/class-wpvr-public.php:205 | |
| 2829 | +#, fuzzy | |
| 2830 | +msgid "Scene menu" | |
| 2831 | +msgstr "Typ sceny" | |
| 2832 | + | |
| 2833 | +#: legacy/public/class-wpvr-public.php:206 | |
| 2834 | +#, fuzzy | |
| 2835 | +msgid "Previous scene" | |
| 2836 | +msgstr "dawny" | |
| 2837 | + | |
| 2838 | +#: legacy/public/class-wpvr-public.php:207 | |
| 2839 | +msgid "Next scene" | |
| 1280 | 2840 | msgstr "" |
| 1281 | 2841 | |
| 1282 | -#: admin/class-wpvr-admin.php:259 | |
| 1283 | -msgid "Setup" | |
| 2842 | +#: legacy/public/class-wpvr-public.php:208 | |
| 2843 | +msgid "Look up" | |
| 1284 | 2844 | msgstr "" |
| 1285 | 2845 | |
| 1286 | -#: admin/partials/wpvr_documentation.php:174 | |
| 1287 | -msgid "Share On" | |
| 1288 | -msgstr "Podziel się na" | |
| 2846 | +#: legacy/public/class-wpvr-public.php:209 | |
| 2847 | +msgid "Look down" | |
| 2848 | +msgstr "" | |
| 1289 | 2849 | |
| 1290 | -#: admin/classes/class-wpvr-general.php:116 | |
| 1291 | -msgid "Share your tour" | |
| 2850 | +#: legacy/public/class-wpvr-public.php:210 | |
| 2851 | +msgid "Look left" | |
| 1292 | 2852 | msgstr "" |
| 1293 | 2853 | |
| 1294 | -#: wpvr.php:2645 | |
| 1295 | -msgid "" | |
| 1296 | -"Since you have updated the plugin, please clear the browser cache for smooth " | |
| 1297 | -"functioning. Follow these steps if you are using <a href=\"https://support." | |
| 1298 | -"google.com/accounts/answer/32050?co=GENIE.Platform%3DDesktop&hl=en\" " | |
| 1299 | -"target=\"_blank\">Google Chrome</a>, <a href=\"https://support.mozilla." | |
| 1300 | -"org/en-US/kb/how-clear-firefox-cache\" target=\"_blank\">Mozilla Firefox</a>," | |
| 1301 | -" <a href=\"https://clear-my-cache.com/en/apple-mac-os/safari.html\" " | |
| 1302 | -"target=\"_blank\">Safai</a> or <a href=\"https://support.microsoft.com/en-" | |
| 1303 | -"us/help/10607/microsoft-edge-view-delete-browser-history\" target=\"_blank\">" | |
| 1304 | -"Microsoft Edge</a>" | |
| 2854 | +#: legacy/public/class-wpvr-public.php:211 | |
| 2855 | +#, fuzzy | |
| 2856 | +msgid "Look right" | |
| 2857 | +msgstr "Ruszaj w prawo" | |
| 2858 | + | |
| 2859 | +#: legacy/public/class-wpvr-public.php:212 | |
| 2860 | +#, fuzzy | |
| 2861 | +msgid "Zoom in" | |
| 2862 | +msgstr "pomakżyć" | |
| 2863 | + | |
| 2864 | +#: legacy/public/class-wpvr-public.php:213 | |
| 2865 | +#, fuzzy | |
| 2866 | +msgid "Zoom out" | |
| 2867 | +msgstr "pomniejszyć" | |
| 2868 | + | |
| 2869 | +#: legacy/public/class-wpvr-public.php:214 | |
| 2870 | +msgid "Toggle fullscreen" | |
| 1305 | 2871 | msgstr "" |
| 1306 | 2872 | |
| 1307 | -#: admin/partials/wpvr_setup_wizard.php:194 | |
| 1308 | -msgid "Starts from only" | |
| 2873 | +#: legacy/public/class-wpvr-public.php:215 | |
| 2874 | +msgid "Return to starting scene" | |
| 1309 | 2875 | msgstr "" |
| 1310 | 2876 | |
| 1311 | -#: admin/classes/class-wpvr-meta-field.php:412 | |
| 1312 | -msgid "Stop Auto-rotation after" | |
| 2877 | +#: legacy/public/class-wpvr-public.php:216 | |
| 2878 | +#, fuzzy | |
| 2879 | +msgid "Toggle device orientation" | |
| 2880 | +msgstr "Dekoracja tekstu" | |
| 2881 | + | |
| 2882 | +#: legacy/public/class-wpvr-public.php:217 | |
| 2883 | +msgid "Toggle tour audio" | |
| 1313 | 2884 | msgstr "" |
| 1314 | 2885 | |
| 1315 | -#: admin/classes/class-wpvr-meta-field.php:3126 | |
| 1316 | -msgid "Style" | |
| 2886 | +#: legacy/public/class-wpvr-public.php:218 | |
| 2887 | +#, fuzzy | |
| 2888 | +msgid "Toggle scene gallery" | |
| 2889 | +msgstr "Galeria scen" | |
| 2890 | + | |
| 2891 | +#: legacy/public/class-wpvr-public.php:219 | |
| 2892 | +msgid "Open tour video" | |
| 1317 | 2893 | msgstr "" |
| 1318 | 2894 | |
| 1319 | -#: admin/partials/wpvr_documentation.php:211 | |
| 1320 | -msgid "Support" | |
| 1321 | -msgstr "Wsparcie" | |
| 2895 | +#: legacy/public/class-wpvr-public.php:220 | |
| 2896 | +msgid "Open form" | |
| 2897 | +msgstr "" | |
| 1322 | 2898 | |
| 1323 | -#: admin/partials/wpvr_setup_wizard.php:15 | |
| 1324 | -#: admin/partials/wpvr_setup_wizard.php:205 | |
| 1325 | -msgid "Take The Tour" | |
| 2899 | +#: legacy/public/class-wpvr-public.php:221 | |
| 2900 | +msgid "Open floor plan" | |
| 1326 | 2901 | msgstr "" |
| 1327 | 2902 | |
| 1328 | -#: admin/classes/class-wpvr-meta-field.php:1029 | |
| 1329 | -#: admin/classes/class-wpvr-meta-field.php:1090 | |
| 1330 | -#: admin/classes/class-wpvr-meta-field.php:1157 | |
| 1331 | -#: admin/classes/class-wpvr-meta-field.php:1223 | |
| 1332 | -#: admin/classes/class-wpvr-meta-field.php:1282 | |
| 1333 | -msgid "Target Scene ID" | |
| 2903 | +#: legacy/public/class-wpvr-public.php:222 | |
| 2904 | +msgid "View scene from floor plan" | |
| 1334 | 2905 | msgstr "" |
| 1335 | 2906 | |
| 1336 | -#: admin/classes/class-wpvr-meta-field.php:3064 | |
| 1337 | -msgid "Text Decoration" | |
| 2907 | +#: legacy/public/class-wpvr-public.php:223 | |
| 2908 | +#, fuzzy | |
| 2909 | +msgid "Company information" | |
| 2910 | +msgstr "Dodaj informacje o firmie" | |
| 2911 | + | |
| 2912 | +#: legacy/public/class-wpvr-public.php:224 | |
| 2913 | +msgid "Close dialog" | |
| 1338 | 2914 | msgstr "" |
| 1339 | 2915 | |
| 1340 | -#: admin/classes/class-wpvr-meta-field.php:3074 | |
| 1341 | -msgid "Text Transform" | |
| 2916 | +#: legacy/public/class-wpvr-public.php:225 | |
| 2917 | +msgid "Tour dialog" | |
| 1342 | 2918 | msgstr "" |
| 1343 | 2919 | |
| 1344 | -#: admin/partials/wpvr_setup_wizard.php:10 | |
| 1345 | -msgid "Thank you" | |
| 2920 | +#: legacy/public/classes/class-wpvr-shortcode.php:99 | |
| 2921 | +msgid "Invalid Wpvr slug attribute" | |
| 1346 | 2922 | msgstr "" |
| 1347 | 2923 | |
| 1348 | -#: admin/partials/wpvr_documentation.php:1072 | |
| 2924 | +#: legacy/public/classes/class-wpvr-shortcode.php:112 | |
| 1349 | 2925 | msgid "" |
| 1350 | -"The notice will appear on the front end of the virtual tour if viewed from a " | |
| 1351 | -"mobile device." | |
| 2926 | +"Oops! It seems that the entered tour doesn't exist. Please enter correct " | |
| 2927 | +"shortcode.<br>" | |
| 1352 | 2928 | msgstr "" |
| 1353 | 2929 | |
| 1354 | -#: admin/classes/class-wpvr-meta-field.php:163 | |
| 2930 | +#: legacy/public/classes/class-wpvr-shortcode.php:118 legacy/wpvr.php:800 | |
| 1355 | 2931 | msgid "" |
| 1356 | -"This option will display Zoom In, Zoom Out and Full Screen buttons on the " | |
| 1357 | -"tour." | |
| 2932 | +"Oops! It seems like this post isn't published yet. Stay tuned for updates!" | |
| 1358 | 2933 | msgstr "" |
| 2934 | +"Ups! Wygląda na to, że ten post nie został jeszcze opublikowany. Bądź na " | |
| 2935 | +"bieżąco z aktualizacjami!" | |
| 1359 | 2936 | |
| 1360 | -#: admin/classes/class-wpvr-meta-field.php:2269 | |
| 1361 | -msgid "This option will not work if the \"Tour Autoload\" is turned on." | |
| 2937 | +#: legacy/public/classes/class-wpvr-shortcode.php:131 legacy/wpvr.php:721 | |
| 2938 | +msgid "You need to log in to access this content." | |
| 1362 | 2939 | msgstr "" |
| 1363 | 2940 | |
| 1364 | -#: admin/classes/class-wpvr-meta-field.php:214 | |
| 1365 | -msgid "This will set the scene fade effect and execution time." | |
| 2941 | +#: legacy/public/classes/class-wpvr-shortcode.php:179 legacy/wpvr.php:762 | |
| 2942 | +msgid "You do not have access to this content." | |
| 1366 | 2943 | msgstr "" |
| 1367 | 2944 | |
| 1368 | -#: admin/classes/class-wpvr-general.php:95 | |
| 1369 | -msgid "To Embed on External Page:" | |
| 2945 | +#: legacy/wpvr.php:156 | |
| 2946 | +msgid "You are previewing Pro features in action." | |
| 1370 | 2947 | msgstr "" |
| 1371 | 2948 | |
| 1372 | -#: admin/classes/class-wpvr-shortcode.php:39 | |
| 1373 | -#, fuzzy | |
| 1374 | -#| msgid "" | |
| 1375 | -#| "To use this Wpvr tour in your posts or pages use the following shortcode:" | |
| 1376 | -msgid "" | |
| 1377 | -"To use this WP VR tour in your posts or pages use the following shortcode " | |
| 2949 | +#: legacy/wpvr.php:160 | |
| 2950 | +msgid "Normally $99.99/year" | |
| 1378 | 2951 | msgstr "" |
| 1379 | -"Aby użyć tej prezentacji WPVR w swoich postach lub stronach, użyj " | |
| 1380 | -"następującego skrótu:" | |
| 1381 | 2952 | |
| 1382 | -#: admin/classes/class-wpvr-meta-field.php:3146 | |
| 1383 | -msgid "Top" | |
| 2953 | +#: legacy/wpvr.php:161 | |
| 2954 | +msgid "SAVE 20%" | |
| 1384 | 2955 | msgstr "" |
| 1385 | 2956 | |
| 1386 | -#: admin/classes/class-wpvr-meta-field.php:151 | |
| 1387 | -msgid "Tour Autoload" | |
| 2957 | +#: legacy/wpvr.php:163 | |
| 2958 | +msgid "Starting at $79.99/year" | |
| 1388 | 2959 | msgstr "" |
| 1389 | 2960 | |
| 1390 | -#: admin/partials/wpvr_documentation.php:388 | |
| 1391 | -msgid "Tour Background Audio" | |
| 2961 | +#: legacy/wpvr.php:167 | |
| 2962 | +#, fuzzy | |
| 2963 | +msgid "Upgrade to save changes" | |
| 2964 | +msgstr "Uaktualnij do Pro" | |
| 2965 | + | |
| 2966 | +#: legacy/wpvr.php:379 | |
| 2967 | +msgid "By" | |
| 1392 | 2968 | msgstr "" |
| 1393 | 2969 | |
| 1394 | -#: admin/classes/class-wpvr-meta-field.php:733 | |
| 1395 | -msgid "Tour Background Music" | |
| 2970 | +#: legacy/wpvr.php:811 | |
| 2971 | +msgid "" | |
| 2972 | +"Oops! It seems that you have not selected any tour yet. Please select a tour " | |
| 2973 | +"from the dropdown of WPVR block.<br>" | |
| 1396 | 2974 | msgstr "" |
| 1397 | 2975 | |
| 1398 | -#: admin/class-wpvr-admin.php:261 | |
| 1399 | -msgid "Tour Preview" | |
| 2976 | +#: legacy/wpvr.php:4208 | |
| 2977 | +msgid "" | |
| 2978 | +"Since you have updated the plugin, please clear the browser cache for smooth " | |
| 2979 | +"functioning. Follow these steps if you are using <a href=\"https://support." | |
| 2980 | +"google.com/accounts/answer/32050?co=GENIE.Platform%3DDesktop&hl=en\" target=" | |
| 2981 | +"\"_blank\">Google Chrome</a>, <a href=\"https://support.mozilla.org/en-US/kb/" | |
| 2982 | +"how-clear-firefox-cache\" target=\"_blank\">Mozilla Firefox</a>, <a href=" | |
| 2983 | +"\"https://clear-my-cache.com/en/apple-mac-os/safari.html\" target=\"_blank" | |
| 2984 | +"\">Safai</a> or <a href=\"https://support.microsoft.com/en-us/help/10607/" | |
| 2985 | +"microsoft-edge-view-delete-browser-history\" target=\"_blank\">Microsoft " | |
| 2986 | +"Edge</a>" | |
| 1400 | 2987 | msgstr "" |
| 2988 | +"Ponieważ zaktualizowałeś wtyczkę, wyczyść pamięć podręczną przeglądarki, aby " | |
| 2989 | +"zapewnić płynne działanie. Wykonaj następujące kroki, jeśli używasz <a href=" | |
| 2990 | +"\"https://support.google.com/accounts/answer/32050?co=genie.platform" | |
| 2991 | +"%3ddesktop&hl=pl\" target=\"_blank\">google chrome>, <a href=\"https://" | |
| 2992 | +"supportull.molla.org/pl/s/how-clear-acre-cache chrome>, <a href=\"https://" | |
| 2993 | +"www." | |
| 2994 | +"actactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactacktactactactactactactacregweltackactactactactactactactactactactactacregcik-" | |
| 2995 | +"acur-acreg-acrefur-acrefur-" | |
| 2996 | +"supckactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactawna " | |
| 2997 | +"lizak celour-" | |
| 2998 | +"actactactactactactactactactactactactactactactactactactactactactactactac" | |
| 1401 | 2999 | |
| 1402 | -#: admin/classes/class-wpvr-meta-field.php:154 | |
| 1403 | -msgid "Tour Preview Image will not appear if this is turned on." | |
| 3000 | +#: src/Admin/Admin.php:120 | |
| 3001 | +msgid "Edit" | |
| 1404 | 3002 | msgstr "" |
| 1405 | 3003 | |
| 1406 | -#: admin/classes/class-wpvr-admin-pages.php:71 | |
| 1407 | -msgid "Tours" | |
| 3004 | +#: src/Admin/Admin.php:318 src/Admin/UiModeSwitcher.php:33 | |
| 3005 | +msgid "Switch to Classic UI" | |
| 1408 | 3006 | msgstr "" |
| 1409 | 3007 | |
| 1410 | -#: admin/classes/class-wpvr-meta-field.php:713 | |
| 1411 | -#: admin/classes/class-wpvr-meta-field.php:729 | |
| 1412 | -msgid "" | |
| 1413 | -"Turning it On will display a gallery with all the scenes on your tour. By " | |
| 1414 | -"double clicking on a scene thumbnail on the gallery, you can move to that " | |
| 1415 | -"specific scene. The gallery will only show up on the front end and not on " | |
| 1416 | -"the preview." | |
| 3008 | +#: src/Admin/Admin.php:322 src/Admin/UiModeSwitcher.php:37 | |
| 3009 | +msgid "You are using the latest WP VR editor." | |
| 1417 | 3010 | msgstr "" |
| 1418 | 3011 | |
| 1419 | -#: admin/classes/class-wpvr-meta-field.php:721 | |
| 1420 | -msgid "" | |
| 1421 | -"Turning it on will display scene titles on each scene thumbnail inside the " | |
| 1422 | -"Scene Gallery. The Scene IDs will be used as the Scene Title." | |
| 3012 | +#: src/Admin/Admin.php:333 src/Admin/UiModeSwitcher.php:159 | |
| 3013 | +msgid "You are not allowed to switch UI modes." | |
| 1423 | 3014 | msgstr "" |
| 1424 | 3015 | |
| 1425 | -#: admin/classes/class-wpvr-meta-field.php:3067 | |
| 1426 | -msgid "Underline" | |
| 3016 | +#: src/Admin/Admin.php:487 | |
| 3017 | +#, fuzzy | |
| 3018 | +msgid "Create New Tour" | |
| 3019 | +msgstr "Dodaj nową wycieczkę" | |
| 3020 | + | |
| 3021 | +#: src/Admin/Admin.php:488 | |
| 3022 | +msgid "Choose your tour type and get started" | |
| 1427 | 3023 | msgstr "" |
| 1428 | 3024 | |
| 1429 | -#: admin/partials/wpvr_documentation.php:305 | |
| 1430 | -msgid "Unlimited Hotspots (Up to to 5 for a scene in free)" | |
| 3025 | +#: src/Admin/Admin.php:504 | |
| 3026 | +msgid "Enter tour name..." | |
| 1431 | 3027 | msgstr "" |
| 1432 | 3028 | |
| 1433 | -#: admin/partials/wpvr_documentation.php:291 | |
| 1434 | -msgid "Unlimited Scenes (Up to 5 in Free)" | |
| 3029 | +#: src/Admin/Admin.php:508 | |
| 3030 | +msgid "Tour name is required." | |
| 1435 | 3031 | msgstr "" |
| 1436 | 3032 | |
| 1437 | -#: admin/partials/wpvr_setup_wizard.php:112 | |
| 1438 | -msgid "Unlock all these options by upgrading to Premium version" | |
| 3033 | +#: src/Admin/Admin.php:526 | |
| 3034 | +msgid "360° Image" | |
| 1439 | 3035 | msgstr "" |
| 1440 | 3036 | |
| 1441 | -#: admin/partials/wpvr_setup_wizard.php:113 | |
| 1442 | -msgid "Upgrade Now" | |
| 3037 | +#: src/Admin/Admin.php:527 | |
| 3038 | +msgid "Create immersive panoramic image tours" | |
| 1443 | 3039 | msgstr "" |
| 1444 | 3040 | |
| 1445 | -#: admin/partials/wpvr_documentation.php:280 | |
| 1446 | -#: admin/partials/wpvr_documentation.php:749 | |
| 1447 | -msgid "Upgrade to Pro" | |
| 1448 | -msgstr "Przejść na wersje Pro" | |
| 3041 | +#: src/Admin/Admin.php:538 | |
| 3042 | +#, fuzzy | |
| 3043 | +msgid "360° Video" | |
| 3044 | +msgstr "Wideo 360 stopni" | |
| 1449 | 3045 | |
| 1450 | -#: admin/partials/wpvr_documentation.php:169 | |
| 1451 | -#: admin/partials/wpvr_documentation.php:263 | |
| 1452 | -#: admin/partials/wpvr_documentation.php:1162 | |
| 3046 | +#: src/Admin/Admin.php:539 | |
| 3047 | +msgid "Build dynamic video-based experiences" | |
| 3048 | +msgstr "" | |
| 3049 | + | |
| 3050 | +#: src/Admin/Admin.php:547 | |
| 3051 | +msgid "Requires WP VR Pro" | |
| 3052 | +msgstr "" | |
| 3053 | + | |
| 3054 | +#: src/Admin/Admin.php:557 | |
| 1453 | 3055 | #, fuzzy |
| 1454 | -#| msgid "Upgrade to pro" | |
| 1455 | -msgid "Upgrade to Pro " | |
| 1456 | -msgstr "Przejść na wersje Pro" | |
| 3056 | +msgid "Integrate Google Street View locations" | |
| 3057 | +msgstr "Widok ulicy Google" | |
| 1457 | 3058 | |
| 1458 | -#: admin/classes/class-wpvr-meta-field.php:1605 | |
| 1459 | -msgid "Upload or Add Link" | |
| 3059 | +#: src/Admin/Admin.php:571 | |
| 3060 | +msgid "+ Create Tour" | |
| 1460 | 3061 | msgstr "" |
| 1461 | 3062 | |
| 1462 | -#: admin/classes/class-tour-guide-translation.php:20 | |
| 1463 | -msgid "Upload Panorama Image" | |
| 3063 | +#: src/Admin/UiModeSwitcher.php:34 | |
| 3064 | +msgid "Switch to New UI" | |
| 1464 | 3065 | msgstr "" |
| 1465 | 3066 | |
| 1466 | -#: admin/classes/class-wpvr-meta-field.php:3077 | |
| 1467 | -msgid "Uppercase" | |
| 3067 | +#: src/Admin/UiModeSwitcher.php:38 | |
| 3068 | +msgid "You are using the classic WP VR editor." | |
| 1468 | 3069 | msgstr "" |
| 1469 | 3070 | |
| 1470 | -#: admin/classes/class-wpvr-meta-field.php:1003 | |
| 1471 | -#: admin/classes/class-wpvr-meta-field.php:1059 | |
| 1472 | -#: admin/classes/class-wpvr-meta-field.php:1126 | |
| 1473 | -#: admin/classes/class-wpvr-meta-field.php:1192 | |
| 1474 | -#: admin/classes/class-wpvr-meta-field.php:1252 | |
| 1475 | -msgid "URL" | |
| 3071 | +#: src/Api/Controllers/TourController.php:87 | |
| 3072 | +#: src/Api/Controllers/TourController.php:103 | |
| 3073 | +#: src/Api/Controllers/TourController.php:136 | |
| 3074 | +msgid "Tour not found." | |
| 1476 | 3075 | msgstr "" |
| 1477 | 3076 | |
| 1478 | -#: admin/classes/class-wpvr-general.php:99 | |
| 1479 | -msgid "Use the iframe below to share this tour on an external page." | |
| 3077 | +#: src/Api/Controllers/TourController.php:110 | |
| 3078 | +msgid "Save failed." | |
| 1480 | 3079 | msgstr "" |
| 1481 | 3080 | |
| 1482 | -#: admin/classes/class-wpvr-general.php:89 | |
| 1483 | -#: admin/classes/class-wpvr-shortcode.php:32 | |
| 1484 | -msgid "Using this Tour" | |
| 3081 | +#: src/Api/Controllers/TourController.php:124 | |
| 3082 | +msgid "Tour title or status could not be saved." | |
| 1485 | 3083 | msgstr "" |
| 1486 | 3084 | |
| 1487 | -#: oxygen/elements/Wpvr_Tour_Element.php:57 | |
| 1488 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:160 | |
| 1489 | -msgid "vh" | |
| 3085 | +#: src/Api/Controllers/TourController.php:140 | |
| 3086 | +msgid "Tour could not be deleted." | |
| 1490 | 3087 | msgstr "" |
| 1491 | 3088 | |
| 1492 | -#: admin/classes/class-wpvr-meta-field.php:115 | |
| 1493 | -msgid "Video" | |
| 3089 | +#: wpvr.php:415 | |
| 3090 | +msgid "Please Activate your license key to enjoy the pro features for WPVR" | |
| 1494 | 3091 | msgstr "" |
| 1495 | 3092 | |
| 1496 | -#: admin/classes/class-wpvr-video.php:46 | |
| 1497 | -msgid "Video Settings : " | |
| 3093 | +#: wpvr.php:417 | |
| 3094 | +#, fuzzy | |
| 3095 | +msgid "Activate" | |
| 3096 | +msgstr "Aktywuj licencję" | |
| 3097 | + | |
| 3098 | +#: wpvr.php:423 | |
| 3099 | +msgid "Your WPVR Pro license has expired." | |
| 1498 | 3100 | msgstr "" |
| 1499 | 3101 | |
| 1500 | -#: admin/partials/wpvr_documentation.php:109 | |
| 1501 | -msgid "Video Tutorials" | |
| 1502 | -msgstr "Samouczki wideo" | |
| 1503 | - | |
| 1504 | -#: admin/partials/wpvr_documentation.php:512 | |
| 1505 | -msgid "VR Glass Support for Video Tours" | |
| 3102 | +#: wpvr.php:424 | |
| 3103 | +msgid "Your WPVR Pro license is not active." | |
| 1506 | 3104 | msgstr "" |
| 1507 | 3105 | |
| 1508 | -#: admin/partials/wpvr_documentation.php:1079 | |
| 1509 | -msgid "VR GLass Support:" | |
| 3106 | +#: wpvr.php:425 | |
| 3107 | +msgid "" | |
| 3108 | +"Pro features are no longer available. Upgrade to Pro now to restore access " | |
| 3109 | +"to all premium features." | |
| 1510 | 3110 | msgstr "" |
| 1511 | 3111 | |
| 1512 | -#: oxygen/elements/Wpvr_Tour_Element.php:78 | |
| 1513 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:120 | |
| 1514 | -msgid "vw" | |
| 3112 | +#: wpvr.php:449 | |
| 3113 | +msgid "Dismiss this notice." | |
| 1515 | 3114 | msgstr "" |
| 1516 | 3115 | |
| 1517 | -#: admin/classes/class-wpvr-meta-field.php:408 | |
| 1518 | -msgid "" | |
| 1519 | -"When someone clicks on the tour, auto-rotation stops. Here, set a time after " | |
| 1520 | -"which auto rotation will start again. Assign in milliseconds, where 1000 " | |
| 1521 | -"milliseconds = 1 second." | |
| 3116 | +#: app/components/modals/CreateSceneModal.jsx:41 | |
| 3117 | +msgid "Selected image" | |
| 1522 | 3118 | msgstr "" |
| 1523 | 3119 | |
| 1524 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:103 | |
| 1525 | -msgid "Width" | |
| 3120 | +#: app/components/modals/CreateSceneModal.jsx:128 | |
| 3121 | +msgid "You cannot add any more scenes in this operation." | |
| 1526 | 3122 | msgstr "" |
| 1527 | 3123 | |
| 1528 | -#: admin/classes/class-wpvr-meta-field.php:3121 | |
| 1529 | -msgid "Width (px)" | |
| 3124 | +#. translators: %d: number of images that can still be selected. | |
| 3125 | +#: app/components/modals/CreateSceneModal.jsx:134 | |
| 3126 | +msgid "You can add only %d more image(s) in this operation." | |
| 1530 | 3127 | msgstr "" |
| 1531 | 3128 | |
| 1532 | -#: oxygen/elements/Wpvr_Tour_Element.php:83 | |
| 1533 | -msgid "Width Fullwidth" | |
| 3129 | +#. translators: %s: comma-separated invalid image file names. | |
| 3130 | +#: app/components/modals/CreateSceneModal.jsx:152 | |
| 3131 | +msgid "Unsupported image file(s): %s. Please use JPEG, PNG, TIFF, or WebP." | |
| 1534 | 3132 | msgstr "" |
| 1535 | 3133 | |
| 1536 | -#: oxygen/elements/Wpvr_Tour_Element.php:70 | |
| 1537 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:114 | |
| 1538 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:115 | |
| 1539 | -msgid "Width Unit" | |
| 3134 | +#. translators: %d: position of the new scene in the current operation. | |
| 3135 | +#: app/components/modals/CreateSceneModal.jsx:173 | |
| 3136 | +msgid "Untitled Scene - %d" | |
| 1540 | 3137 | msgstr "" |
| 1541 | 3138 | |
| 1542 | -#: elementor/elements/Wpvr-widget.php:165 | |
| 1543 | -msgid "Width:" | |
| 1544 | -msgstr "Szerokość:" | |
| 3139 | +#: app/components/modals/CreateSceneModal.jsx:234 | |
| 3140 | +#, fuzzy | |
| 3141 | +msgid "Select Panorama Images" | |
| 3142 | +msgstr "Prześlij obraz panoramy" | |
| 1545 | 3143 | |
| 1546 | -#: admin/partials/wpvr_documentation.php:1100 | |
| 1547 | -msgid "" | |
| 1548 | -"Will activate the VR Glass support on mobile devices. This is the Beta " | |
| 1549 | -"release. So, if you face any issues with it, please contact us at " | |
| 1550 | -"[email protected]" | |
| 3144 | +#: app/components/modals/CreateSceneModal.jsx:235 | |
| 3145 | +msgid "Use these images" | |
| 1551 | 3146 | msgstr "" |
| 1552 | 3147 | |
| 1553 | -#: admin/partials/wpvr_documentation.php:1126 | |
| 1554 | -msgid "" | |
| 1555 | -"Will convert any jpeg or png image to webp format during media upload. will " | |
| 1556 | -"decrease the image size with no quality compromise and help the site to load " | |
| 1557 | -"faster." | |
| 3148 | +#: app/components/modals/CreateSceneModal.jsx:339 | |
| 3149 | +msgid "Enter a name for every scene before creating." | |
| 1558 | 3150 | msgstr "" |
| 1559 | 3151 | |
| 1560 | -#: admin/partials/wpvr_documentation.php:333 | |
| 1561 | -msgid "WooCommerce Add-on" | |
| 3152 | +#. translators: %s: comma-separated file names that failed to upload. | |
| 3153 | +#: app/components/modals/CreateSceneModal.jsx:398 | |
| 3154 | +msgid "Could not upload: %s. Please try creating the scenes again." | |
| 1562 | 3155 | msgstr "" |
| 1563 | 3156 | |
| 1564 | -#: admin/classes/class-wpvr-meta-field.php:3108 | |
| 1565 | -msgid "Word Spacing (px)" | |
| 3157 | +#: app/components/modals/CreateSceneModal.jsx:418 | |
| 3158 | +msgid "Unable to create the selected scenes. Please try again." | |
| 1566 | 3159 | msgstr "" |
| 1567 | 3160 | |
| 1568 | -#: admin/partials/wpvr_documentation.php:930 | |
| 1569 | -msgid "" | |
| 1570 | -"WordPress's default large image handler for images larger than 2560px will " | |
| 1571 | -"be disabled for WP VR. So can create virtual tours with extremely high-" | |
| 1572 | -"quality images. Enabling it will also show high res image on mobile devices. " | |
| 1573 | -"Many devices may not support that resolution." | |
| 3161 | +#: app/components/modals/CreateSceneModal.jsx:449 | |
| 3162 | +msgid "+ Create" | |
| 1574 | 3163 | msgstr "" |
| 1575 | 3164 | |
| 1576 | -#. Name of the plugin | |
| 1577 | -msgid "WP VR" | |
| 1578 | -msgstr "WP VR" | |
| 3165 | +#: app/components/modals/CreateSceneModal.jsx:451 | |
| 3166 | +#, fuzzy | |
| 3167 | +msgid "+ Create Scene" | |
| 3168 | +msgstr "Identyfikator sceny docelowe" | |
| 1579 | 3169 | |
| 1580 | -#. Description of the plugin | |
| 1581 | -msgid "" | |
| 1582 | -"WP VR - 360 Panorama and virtual tour creator for WordPress is a customized " | |
| 1583 | -"panaroma & virtual builder tool for WordPress Website." | |
| 3170 | +#. translators: %d: number of scenes that will be created. | |
| 3171 | +#: app/components/modals/CreateSceneModal.jsx:455 | |
| 3172 | +msgid "+ Create %d Scenes" | |
| 1584 | 3173 | msgstr "" |
| 1585 | -"WP VR - 360 Panorama i kreator wirtualnych tras dla WordPress jest " | |
| 1586 | -"dostosowanym narzędziem do tworzenia panoram i wirtualnych kreacji dla " | |
| 1587 | -"witryny WordPress." | |
| 1588 | 3174 | |
| 1589 | -#: admin/partials/wpvr_documentation.php:983 | |
| 1590 | -#: admin/partials/wpvr_documentation.php:1023 | |
| 1591 | -msgid "" | |
| 1592 | -"WP VR assets will be loaded on your allowed pages only. If you turn this on, " | |
| 1593 | -"you have to list the URL's of the pages with virtual tours on the 'List of " | |
| 1594 | -"allowed pages to load WP VR scripts' option" | |
| 3175 | +#: app/components/modals/CreateSceneModal.jsx:465 | |
| 3176 | +msgid "Create scenes" | |
| 1595 | 3177 | msgstr "" |
| 1596 | 3178 | |
| 1597 | -#: admin/class-wpvr-rollback.php:160 | |
| 1598 | -msgid "WP VR Plugin Rollback" | |
| 3179 | +#: app/components/modals/CreateSceneModal.jsx:470 | |
| 3180 | +msgid "Upload Scene" | |
| 1599 | 3181 | msgstr "" |
| 1600 | 3182 | |
| 1601 | -#: admin/partials/wpvr_documentation.php:878 | |
| 1602 | -msgid "WP VR will not load Font Awesome library." | |
| 3183 | +#: app/components/modals/CreateSceneModal.jsx:494 | |
| 3184 | +msgid "Drag and drop your 360° panorama images here" | |
| 1603 | 3185 | msgstr "" |
| 1604 | 3186 | |
| 1605 | -#: admin/partials/wpvr_documentation.php:904 | |
| 1606 | -msgid "WP VR will resize each scenes for mobile devices." | |
| 3187 | +#: app/components/modals/CreateSceneModal.jsx:501 | |
| 3188 | +msgid "Supports JPEG, PNG, TIFF, WebP" | |
| 1607 | 3189 | msgstr "" |
| 1608 | 3190 | |
| 1609 | -#: admin/partials/wpvr_documentation.php:233 | |
| 1610 | -msgid "WPFunnels" | |
| 3191 | +#: app/components/modals/CreateSceneModal.jsx:514 | |
| 3192 | +msgid "Browse Files" | |
| 1611 | 3193 | msgstr "" |
| 1612 | 3194 | |
| 1613 | -#: elementor/elements/Wpvr-widget.php:44 | |
| 1614 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:21 | |
| 1615 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:27 | |
| 1616 | -#, fuzzy | |
| 1617 | -#| msgid "Wpvr" | |
| 1618 | -msgid "WPVR" | |
| 1619 | -msgstr "WPVR" | |
| 1620 | - | |
| 1621 | -#: admin/partials/wpvr_documentation.php:278 | |
| 1622 | -msgid "WPVR Feature Comparison" | |
| 3195 | +#. translators: 1: number of uploaded images, 2: total image uploads. | |
| 3196 | +#: app/components/modals/CreateSceneModal.jsx:529 | |
| 3197 | +msgid "Uploading %1$d of %2$d images…" | |
| 1623 | 3198 | msgstr "" |
| 1624 | 3199 | |
| 1625 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:148 | |
| 1626 | -msgid "WPVR Height" | |
| 3200 | +#. translators: 1: number of selected scenes, 2: maximum scenes allowed in this operation. | |
| 3201 | +#: app/components/modals/CreateSceneModal.jsx:543 | |
| 3202 | +msgid "%1$d of %2$d scenes selected." | |
| 1627 | 3203 | msgstr "" |
| 1628 | 3204 | |
| 1629 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:193 | |
| 1630 | -msgid "WPVR Mobile Height" | |
| 3205 | +#. translators: %d: number of scenes that can still be added in this operation. | |
| 3206 | +#: app/components/modals/CreateSceneModal.jsx:554 | |
| 3207 | +msgid "You can add %d more scene(s) with your current limit." | |
| 1631 | 3208 | msgstr "" |
| 1632 | 3209 | |
| 1633 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:171 | |
| 1634 | -msgid "WPVR Radius" | |
| 3210 | +#. translators: %s: image file name. | |
| 3211 | +#: app/components/modals/CreateSceneModal.jsx:584 | |
| 3212 | +msgid "Remove %s" | |
| 1635 | 3213 | msgstr "" |
| 1636 | 3214 | |
| 1637 | -#: elementor/elements/Wpvr-widget.php:146 | |
| 3215 | +#: app/components/modals/CreateSceneModal.jsx:599 | |
| 1638 | 3216 | #, fuzzy |
| 1639 | -#| msgid "Wpvr Setup" | |
| 1640 | -msgid "WPVR Setup" | |
| 1641 | -msgstr "Konfiguracja WPVR" | |
| 3217 | +msgid "Scene name" | |
| 3218 | +msgstr "Typ sceny" | |
| 1642 | 3219 | |
| 1643 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:92 | |
| 1644 | -msgid "WPVR Tour ID" | |
| 3220 | +#: app/components/modals/ImageResizeWarningModal.jsx:59 | |
| 3221 | +msgid "Could not save the setting. Please try again." | |
| 1645 | 3222 | msgstr "" |
| 1646 | 3223 | |
| 1647 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:104 | |
| 1648 | -msgid "WPVR Width" | |
| 3224 | +#: legacy/src/index.js:42 | |
| 3225 | +msgid "Solid" | |
| 1649 | 3226 | msgstr "" |
| 1650 | 3227 | |
| 1651 | -#: admin/classes/class-wpvr-meta-field.php:310 | |
| 1652 | -msgid "Write your custom css" | |
| 3228 | +#: legacy/src/index.js:43 | |
| 3229 | +msgid "Dotted" | |
| 1653 | 3230 | msgstr "" |
| 1654 | 3231 | |
| 1655 | -#: admin/classes/class-wpvr-meta-field.php:971 | |
| 1656 | -msgid "Yaw" | |
| 3232 | +#: legacy/src/index.js:44 | |
| 3233 | +msgid "Dashed" | |
| 1657 | 3234 | msgstr "" |
| 1658 | 3235 | |
| 1659 | -#: admin/classes/class-wpvr-meta-field.php:1650 | |
| 1660 | -#: admin/partials/wpvr_confirmation_alert.php:29 | |
| 1661 | -#: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:136 | |
| 1662 | -msgid "Yes" | |
| 3236 | +#: legacy/src/index.js:45 | |
| 3237 | +msgid "Double" | |
| 1663 | 3238 | msgstr "" |
| 1664 | 3239 | |
| 1665 | -#: admin/partials/wpvr_documentation.php:956 | |
| 1666 | -msgid "" | |
| 1667 | -"You can disable on hover content for mobile devices. As most of the devices " | |
| 1668 | -"are touch based." | |
| 3240 | +#: legacy/src/index.js:132 | |
| 3241 | +#, fuzzy | |
| 3242 | +msgid "Tour Settings" | |
| 3243 | +msgstr "Ustawienie" | |
| 3244 | + | |
| 3245 | +#: legacy/src/index.js:187 | |
| 3246 | +msgid "Appearance" | |
| 1669 | 3247 | msgstr "" |
| 1670 | 3248 | |
| 1671 | -#: admin/classes/class-wpvr-meta-field.php:1783 | |
| 1672 | -#: admin/classes/class-wpvr-meta-field.php:1818 | |
| 1673 | -msgid "" | |
| 1674 | -"You can use any image size but maximum image upload size recommended to " | |
| 1675 | -"support all device is 4096x2000 px for perfect responsive view. To check 360 " | |
| 1676 | -"view, click on preview button and check tour preview metabox." | |
| 3249 | +#: legacy/src/index.js:189 | |
| 3250 | +#, fuzzy | |
| 3251 | +msgid "Tour Border Radius" | |
| 3252 | +msgstr "Promień granicy (PX)" | |
| 3253 | + | |
| 3254 | +#: legacy/src/index.js:204 | |
| 3255 | +msgid "Tour Border Width" | |
| 1677 | 3256 | msgstr "" |
| 1678 | 3257 | |
| 1679 | -#: admin/classes/class-tour-guide-translation.php:29 | |
| 1680 | -msgid "Your Image In Tour Mode" | |
| 3258 | +#: legacy/src/index.js:212 | |
| 3259 | +msgid "Tour Border Style" | |
| 1681 | 3260 | msgstr "" |
| 1682 | 3261 | |
| 1683 | -#: admin/partials/wpvr_documentation.php:221 | |
| 1684 | -msgid "" | |
| 1685 | -"Your rating and feedback matters to us. If you are happy with WP VR - 360 " | |
| 1686 | -"Panorama and virtual tour creator for WordPress give us a rating." | |
| 3262 | +#: legacy/src/index.js:219 | |
| 3263 | +msgid "Tour Border Color" | |
| 1687 | 3264 | msgstr "" |
| 1688 | -"Twoja ocena i opinie są dla nas ważne. Jeśli jesteś zadowolony z WP VR - 360 " | |
| 1689 | -"Panorama i twórcy wirtualnej wycieczki dla WordPress, daj nam ocenę." | |
| 1690 | 3265 | |
| 1691 | -#: admin/partials/wpvr_setup_wizard.php:125 | |
| 1692 | -msgid "Your Viewers - And Make Them Take" | |
| 3266 | +#: legacy/src/index.js:235 | |
| 3267 | +#, fuzzy | |
| 3268 | +msgid "WPVR Tour Preview" | |
| 3269 | +msgstr "Podgląd wycieczki" | |
| 3270 | + | |
| 3271 | +#: legacy/src/index.js:238 | |
| 3272 | +msgid "Width" | |
| 3273 | +msgstr "szerokość" | |
| 3274 | + | |
| 3275 | +#: legacy/src/index.js:239 | |
| 3276 | +msgid "Height" | |
| 3277 | +msgstr "zenit" | |
| 3278 | + | |
| 3279 | +#: legacy/src/index.js:241 | |
| 3280 | +msgid "Radius" | |
| 3281 | +msgstr "promień" | |
| 3282 | + | |
| 3283 | +#: legacy/src/index.js:247 | |
| 3284 | +msgid "Please select a tour from the block settings panel." | |
| 1693 | 3285 | msgstr "" |
| 1694 | 3286 | |
| 1695 | -#: admin/classes/class-wpvr-meta-field.php:801 | |
| 1696 | -msgid "Zoom In" | |
| 3287 | +#: legacy/src/index.js:258 | |
| 3288 | +#, fuzzy | |
| 3289 | +msgid "WPVR Tour" | |
| 3290 | +msgstr "Identyfikator trasy WPVR" | |
| 3291 | + | |
| 3292 | +#: legacy/src/index.js:259 | |
| 3293 | +msgid "Add a virtual reality tour to your content." | |
| 1697 | 3294 | msgstr "" |
| 1698 | 3295 | |
| 1699 | -#: admin/classes/class-wpvr-meta-field.php:752 | |
| 1700 | -msgid "" | |
| 1701 | -"Zoom interval is 50 to 120 degree. You can put any value between 50 to 120. " | |
| 1702 | -"As an example, if you set 100, the scene will display with zoom in 100 " | |
| 1703 | -"degree on each load." | |
| 3296 | +#: legacy/src/index.js:262 | |
| 3297 | +msgid "vr" | |
| 1704 | 3298 | msgstr "" |
| 1705 | 3299 | |
| 1706 | -#: admin/classes/class-wpvr-meta-field.php:820 | |
| 1707 | -msgid "Zoom Out" | |
| 3300 | +#: legacy/src/index.js:262 | |
| 3301 | +msgid "tour" | |
| 1708 | 3302 | msgstr "" |
| 3303 | + | |
| 3304 | +#: legacy/src/index.js:262 | |
| 3305 | +#, fuzzy | |
| 3306 | +msgid "panorama" | |
| 3307 | +msgstr "Mobilna panorama" | |
| 3308 | + | |
| 3309 | +#: legacy/src/index.js:262 | |
| 3310 | +msgid "virtual reality" | |
| 3311 | +msgstr "" | |
| 3312 | + | |
| 3313 | +#~ msgid " : " | |
| 3314 | +#~ msgstr ": :" | |
| 3315 | + | |
| 3316 | +#~ msgid "360 Degree Panorama" | |
| 3317 | +#~ msgstr "Panorama 360 stopni" | |
| 3318 | + | |
| 3319 | +#~ msgid ": " | |
| 3320 | +#~ msgstr ": :" | |
| 3321 | + | |
| 3322 | +#~ msgid "add" | |
| 3323 | +#~ msgstr "dopłacać" | |
| 3324 | + | |
| 3325 | +#~ msgid "" | |
| 3326 | +#~ "Add a Hotspot inside your tour to show additional information like " | |
| 3327 | +#~ "Paragraph, Heading, Image, Video, or multiple content." | |
| 3328 | +#~ msgstr "" | |
| 3329 | +#~ "Dodaj hotspot do wycieczki, aby wyświetlić dodatkowe informacje, takie " | |
| 3330 | +#~ "jak akapit, nagłówek, obraz, wideo lub wiele treści." | |
| 3331 | + | |
| 3332 | +#~ msgid "Add Scene ID " | |
| 3333 | +#~ msgstr "Dodaj identyfikator sceny" | |
| 3334 | + | |
| 3335 | +#~ msgid "Add-ons" | |
| 3336 | +#~ msgstr "dodatki" | |
| 3337 | + | |
| 3338 | +#~ msgid "Assign Pitch & Yaw" | |
| 3339 | +#~ msgstr "Przypisz skok i odchyl" | |
| 3340 | + | |
| 3341 | +#~ msgid "Back to WPVR Dashboard" | |
| 3342 | +#~ msgstr "Powrót do WPVR Pulpit nawigacyjny" | |
| 3343 | + | |
| 3344 | +#~ msgid "Background Audio" | |
| 3345 | +#~ msgstr "Dźwięk w tle" | |
| 3346 | + | |
| 3347 | +#~ msgid "" | |
| 3348 | +#~ "Before You start, you can check our Documentation to get familiar with WP " | |
| 3349 | +#~ "VR - 360 Panorama and virtual tour creator for WordPress." | |
| 3350 | +#~ msgstr "" | |
| 3351 | +#~ "Zanim zaczniesz, możesz sprawdzić naszą dokumentację, aby zapoznać się z " | |
| 3352 | +#~ "WP VR - 360 Panorama i Virtual Tour Creator dla WordPress." | |
| 3353 | + | |
| 3354 | +#~ msgid "Best WordPress Plugin" | |
| 3355 | +#~ msgstr "Najlepsza wtyczka WordPress" | |
| 3356 | + | |
| 3357 | +#~ msgid "Call to action button text" | |
| 3358 | +#~ msgstr "Tekst przycisku wezwania do działania" | |
| 3359 | + | |
| 3360 | +#~ msgid "" | |
| 3361 | +#~ "Can't find solution on with our documentation? Just Post a ticket on " | |
| 3362 | +#~ "Support forum. We are to solve your issue." | |
| 3363 | +#~ msgstr "" | |
| 3364 | +#~ "Nie możesz znaleźć rozwiązania z naszą dokumentacją? Po prostu opublikuj " | |
| 3365 | +#~ "bilet na forum pomocy technicznej. Mamy rozwiązać Twój problem." | |
| 3366 | + | |
| 3367 | +#~ msgid "Cart Lift" | |
| 3368 | +#~ msgstr "Wózek podnośnikowy" | |
| 3369 | + | |
| 3370 | +#~ msgid "Check out our other amazing free plugins!" | |
| 3371 | +#~ msgstr "Sprawdź nasze inne niesamowite darmowe wtyczki!" | |
| 3372 | + | |
| 3373 | +#~ msgid "Checkout All Features" | |
| 3374 | +#~ msgstr "Sprawdź wszystkie funkcje" | |
| 3375 | + | |
| 3376 | +#~ msgid "Choose The Spot" | |
| 3377 | +#~ msgstr "Wybierz miejsce" | |
| 3378 | + | |
| 3379 | +#~ msgid "" | |
| 3380 | +#~ "Click on Preview to see how the content is appearing for the hotspot." | |
| 3381 | +#~ msgstr "" | |
| 3382 | +#~ "Kliknij podgląd, aby zobaczyć, jak treść wyświetla się dla hotspotu." | |
| 3383 | + | |
| 3384 | +#~ msgid "" | |
| 3385 | +#~ "Click on the Preview button to view your uploaded panorama in virtual " | |
| 3386 | +#~ "tour mode." | |
| 3387 | +#~ msgstr "" | |
| 3388 | +#~ "Kliknij przycisk Podgląd, aby wyświetlić przesłaną panoramę w trybie " | |
| 3389 | +#~ "wirtualnej wycieczki." | |
| 3390 | + | |
| 3391 | +#~ msgid "" | |
| 3392 | +#~ "Click on the Update button to save your work. And just like that, you can " | |
| 3393 | +#~ "create an unlimited number of virtual tours and add your customization to " | |
| 3394 | +#~ "them." | |
| 3395 | +#~ msgstr "" | |
| 3396 | +#~ "Kliknij przycisk Aktualizuj, aby zapisać swoją pracę. I tak po prostu " | |
| 3397 | +#~ "możesz tworzyć nieograniczoną liczbę wirtualnych wycieczek i dodawać do " | |
| 3398 | +#~ "nich swoją personalizację." | |
| 3399 | + | |
| 3400 | +#~ msgid "Click on the Upload button to upload your panorama image." | |
| 3401 | +#~ msgstr "Kliknij przycisk Prześlij, aby przesłać obraz panoramy." | |
| 3402 | + | |
| 3403 | +#~ msgid "" | |
| 3404 | +#~ "Click on this Publish button to save this as a tour. You can always find " | |
| 3405 | +#~ "it in your tour list." | |
| 3406 | +#~ msgstr "" | |
| 3407 | +#~ "Kliknij ten przycisk Publikuj, aby zapisać to jako wycieczkę. Zawsze " | |
| 3408 | +#~ "możesz go znaleźć na swojej liście wycieczek." | |
| 3409 | + | |
| 3410 | +#~ msgid "Click to Upload an Image " | |
| 3411 | +#~ msgstr "Kliknij, aby przesłać obraz" | |
| 3412 | + | |
| 3413 | +#~ msgid "Contact Our Support" | |
| 3414 | +#~ msgstr "Skontaktuj się z naszym wsparciem" | |
| 3415 | + | |
| 3416 | +#~ msgid "Continue to guide" | |
| 3417 | +#~ msgstr "Kontynuuj do przewodnika" | |
| 3418 | + | |
| 3419 | +#~ msgid "" | |
| 3420 | +#~ "Create high-converting slaes funnels on a visual drag & drop funnel " | |
| 3421 | +#~ "builder canvas and increase your online sales from today." | |
| 3422 | +#~ msgstr "" | |
| 3423 | +#~ "Twórz ścieżki SLAES o wysokim konwersji na wizualnym kanwie konstruktora " | |
| 3424 | +#~ "lejka przeciągnij i upuść i zwiększ sprzedaż online od dzisiaj." | |
| 3425 | + | |
| 3426 | +#~ msgid "Cubemap Images" | |
| 3427 | +#~ msgstr "Obrazy z mapą" | |
| 3428 | + | |
| 3429 | +#~| msgid "Custom control buttons" | |
| 3430 | +#~ msgid "Custom Control Buttons" | |
| 3431 | +#~ msgstr "Niestandardowe przyciski sterowania" | |
| 3432 | + | |
| 3433 | +#~ msgid "" | |
| 3434 | +#~ "Custom icons will only show on frontend. Hotspot custom icons only works " | |
| 3435 | +#~ "with fontawesome 5. If you are using any different version of fontawesome " | |
| 3436 | +#~ "under theme or any plugin, you may deactivate fontawesome from WP VR. Go " | |
| 3437 | +#~ "to \"Get Started menu\" and select \"Role\" and check fontawesome disable " | |
| 3438 | +#~ "switch. Now put your desired any icon class under \"Hotspot custom icon " | |
| 3439 | +#~ "class\" field. It will appear on the frontend." | |
| 3440 | +#~ msgstr "" | |
| 3441 | +#~ "Niestandardowe ikony będą wyświetlane tylko na frontend. Niestandardowe " | |
| 3442 | +#~ "ikony Hotspot działa tylko z FontaWesome 5. Jeśli używasz innej wersji " | |
| 3443 | +#~ "FontaWesome pod motywem lub jakąkolwiek wtyczką, możesz dezaktywować " | |
| 3444 | +#~ "FontaWesome z WP VR. Przejdź do \"Menu Rozpocznij\" i wybierz \"Role\" i " | |
| 3445 | +#~ "zaznacz FontaWesome Disable Switch. Teraz umieść żądaną klasę ikon w polu " | |
| 3446 | +#~ "„Hotspot Custom Icon Class”. Pojawi się na froncie." | |
| 3447 | + | |
| 3448 | +#~ msgid "Decisions" | |
| 3449 | +#~ msgstr "decyzja" | |
| 3450 | + | |
| 3451 | +#~ msgid "Disable keyboard control to use the form." | |
| 3452 | +#~ msgstr "Wyłącz kontrolę klawiatury, aby użyć formularza." | |
| 3453 | + | |
| 3454 | +#~ msgid "" | |
| 3455 | +#~ "Do not close or refresh the page during import process. It may take few " | |
| 3456 | +#~ "minutes." | |
| 3457 | +#~ msgstr "" | |
| 3458 | +#~ "Nie zamykaj ani nie odświeżaj strony podczas procesu importowania. Może " | |
| 3459 | +#~ "to zająć kilka minut." | |
| 3460 | + | |
| 3461 | +#~ msgid "" | |
| 3462 | +#~ "Editors will be able to Create, Edit, Update, and Delete all virtual " | |
| 3463 | +#~ "tours." | |
| 3464 | +#~ msgstr "" | |
| 3465 | +#~ "Edytorzy będą mogli tworzyć, edytować, aktualizować i usuwać wszystkie " | |
| 3466 | +#~ "wirtualne wycieczki." | |
| 3467 | + | |
| 3468 | +#~ msgid "Enable the call to action, it will render under the tour." | |
| 3469 | +#~ msgstr "Włącz wezwanie do działania, zostanie wyrenderowane w ramach trasy." | |
| 3470 | + | |
| 3471 | +#~ msgid "Enable Video" | |
| 3472 | +#~ msgstr "Włącz wideo" | |
| 3473 | + | |
| 3474 | +#~ msgid "Explainer" | |
| 3475 | +#~ msgstr "wyjaśniacz" | |
| 3476 | + | |
| 3477 | +#~ msgid "Features That Can" | |
| 3478 | +#~ msgstr "Funkcje, które mogą" | |
| 3479 | + | |
| 3480 | +#~ msgid "Follow the Guided Wizard and Learn How it Works." | |
| 3481 | +#~ msgstr "" | |
| 3482 | +#~ "Postępuj zgodnie z przewodnikiem kreatora i dowiedz się, jak to działa." | |
| 3483 | + | |
| 3484 | +#~ msgid "for Choosing" | |
| 3485 | +#~ msgstr "za wybór" | |
| 3486 | + | |
| 3487 | +#~ msgid "for Virtual Tours, Viewing Panoramas, and 360 Degree Content" | |
| 3488 | +#~ msgstr "" | |
| 3489 | +#~ "W przypadku wirtualnych wycieczek, przeglądania panoram i zawartości 360 " | |
| 3490 | +#~ "stopni" | |
| 3491 | + | |
| 3492 | +#~ msgid "Full Screen" | |
| 3493 | +#~ msgstr "pełny ekran" | |
| 3494 | + | |
| 3495 | +#~ msgid "General" | |
| 3496 | +#~ msgstr "gromadny" | |
| 3497 | + | |
| 3498 | +#~ msgid "Get Access to " | |
| 3499 | +#~ msgstr "Uzyskaj dostęp do" | |
| 3500 | + | |
| 3501 | +#~ msgid "Get It Now" | |
| 3502 | +#~ msgstr "Pobierz to teraz" | |
| 3503 | + | |
| 3504 | +#~ msgid "Get Pro Now" | |
| 3505 | +#~ msgstr "Zdobądź profesjonalistę" | |
| 3506 | + | |
| 3507 | +#~ msgid "Give a name to your virtual tour." | |
| 3508 | +#~ msgstr "Nadaj nazwę swojej wirtualnej trasie." | |
| 3509 | + | |
| 3510 | +#~ msgid "Gyroscope" | |
| 3511 | +#~ msgstr "giroskop" | |
| 3512 | + | |
| 3513 | +#~ msgid "" | |
| 3514 | +#~ "Here is a preview of your panorama image in tour mode. You can control it " | |
| 3515 | +#~ "and mode around to see it in 360 degree view." | |
| 3516 | +#~ msgstr "" | |
| 3517 | +#~ "Oto podgląd Twojego obrazu panoramy w trybie wycieczki. Możesz nim " | |
| 3518 | +#~ "sterować i trybu wokół, aby zobaczyć go w widoku 360 stopni." | |
| 3519 | + | |
| 3520 | +#~ msgid "Here you can see the Pitch & Yaw has been set for the hotspot." | |
| 3521 | +#~ msgstr "" | |
| 3522 | +#~ "Tutaj możesz zobaczyć, że boisko i Yaw zostało ustawione dla hotspotu." | |
| 3523 | + | |
| 3524 | +#~ msgid "" | |
| 3525 | +#~ "Here, you can set what content your viewer will see after clicking on the " | |
| 3526 | +#~ "Hotspot. You can either set an URL or any other content using this " | |
| 3527 | +#~ "editor. To learn more, follow this guide to set content using editor" | |
| 3528 | +#~ msgstr "" | |
| 3529 | +#~ "Tutaj możesz ustawić, jakie treści zobaczy Twój widz po kliknięciu w " | |
| 3530 | +#~ "hotspot. Możesz ustawić adres URL lub inną zawartość za pomocą tego " | |
| 3531 | +#~ "edytora. Aby dowiedzieć się więcej, postępuj zgodnie z tym przewodnikiem, " | |
| 3532 | +#~ "aby ustawić zawartość za pomocą edytora" | |
| 3533 | + | |
| 3534 | +#~ msgid "Home" | |
| 3535 | +#~ msgstr "ojczyzna" | |
| 3536 | + | |
| 3537 | +#~ msgid "Hook" | |
| 3538 | +#~ msgstr "uczepić" | |
| 3539 | + | |
| 3540 | +#~ msgid "ID" | |
| 3541 | +#~ msgstr "dowód osobisty" | |
| 3542 | + | |
| 3543 | +#~ msgid "ID:" | |
| 3544 | +#~ msgstr "ID:" | |
| 3545 | + | |
| 3546 | +#~ msgid "" | |
| 3547 | +#~ "If set to true, device orientation control will be used when the panorama " | |
| 3548 | +#~ "is loaded, if the device supports it. If false, device orientation " | |
| 3549 | +#~ "control needs to be activated by pressing a button. Defaults to false. " | |
| 3550 | +#~ "Will work if gyroscope is enabled" | |
| 3551 | +#~ msgstr "" | |
| 3552 | +#~ "Jeśli ustawione na true, kontrola orientacji urządzenia będzie używana, " | |
| 3553 | +#~ "gdy panorama jest załadowana, jeśli urządzenie ją obsługuje. Jeśli false, " | |
| 3554 | +#~ "kontrola orientacji urządzenia musi być aktywowana przez naciśnięcie " | |
| 3555 | +#~ "przycisku. domyślnie na false. będzie działać, jeśli żyroskop jest " | |
| 3556 | +#~ "włączony" | |
| 3557 | + | |
| 3558 | +#~ msgid "" | |
| 3559 | +#~ "In this Preview, drag to your desired location and click on it, exactly " | |
| 3560 | +#~ "where you want to set the hotspot" | |
| 3561 | +#~ msgstr "" | |
| 3562 | +#~ "W tym podglądzie przeciągnij do żądanej lokalizacji i kliknij ją, " | |
| 3563 | +#~ "dokładnie tam, gdzie chcesz ustawić hotspot" | |
| 3564 | + | |
| 3565 | +#~ msgid "Learn more" | |
| 3566 | +#~ msgstr "Więcej" | |
| 3567 | + | |
| 3568 | +#~ msgid "Make WPVR Popular" | |
| 3569 | +#~ msgstr "Spraw, aby WPVR był popularny" | |
| 3570 | + | |
| 3571 | +#~ msgid "More Pro Features" | |
| 3572 | +#~ msgstr "Więcej funkcji Pro" | |
| 3573 | + | |
| 3574 | +#~ msgid "Move Up" | |
| 3575 | +#~ msgstr "podnieść" | |
| 3576 | + | |
| 3577 | +#~ msgid "Multiple Content on Hotspots" | |
| 3578 | +#~ msgstr "Wiele treści w hotspotach" | |
| 3579 | + | |
| 3580 | +#~ msgid "" | |
| 3581 | +#~ "Once you see the Pitch & Yaw value for the spot, click on this Arrow. " | |
| 3582 | +#~ "It'll be set as the coordinate for your hotspot" | |
| 3583 | +#~ msgstr "" | |
| 3584 | +#~ "Gdy zobaczysz wartość Pitch & Yaw dla miejsca, kliknij tę strzałkę. " | |
| 3585 | +#~ "zostanie ustawiony jako współrzędna dla twojego hotspotu" | |
| 3586 | + | |
| 3587 | +#~ msgid "Personalize your virtual tours, in the way you want." | |
| 3588 | +#~ msgstr "Spersonalizuj swoje wirtualne wycieczki w sposób, w jaki chcesz." | |
| 3589 | + | |
| 3590 | +#~ msgid "Pitch & Yaw is Set" | |
| 3591 | +#~ msgstr "Pitch & Yaw jest ustawiony" | |
| 3592 | + | |
| 3593 | +#~ msgid "Post a Ticket" | |
| 3594 | +#~ msgstr "Opublikuj bilet" | |
| 3595 | + | |
| 3596 | +#~ msgid "Preview The Image in Tour Mode" | |
| 3597 | +#~ msgstr "Podgląd obrazu w trybie wycieczki" | |
| 3598 | + | |
| 3599 | +#~ msgid "Preview Your Hotspot Content" | |
| 3600 | +#~ msgstr "Wyświetl podgląd zawartości Hotspot" | |
| 3601 | + | |
| 3602 | +#~| msgid "Rate Us! " | |
| 3603 | +#~ msgid "Rate Us " | |
| 3604 | +#~ msgstr "Oceń nas" | |
| 3605 | + | |
| 3606 | +#~ msgid "Read Documentations" | |
| 3607 | +#~ msgstr "Przeczytaj dokumentację" | |
| 3608 | + | |
| 3609 | +#~ msgid "Read Our Complete Guides" | |
| 3610 | +#~ msgstr "Przeczytaj nasze kompletne przewodniki" | |
| 3611 | + | |
| 3612 | +#~ msgid "" | |
| 3613 | +#~ "Recover abandoned carts with automated email drip campaigns. Start " | |
| 3614 | +#~ "getting back lost sales on your online store." | |
| 3615 | +#~ msgstr "" | |
| 3616 | +#~ "Odzyskiwanie porzuconych koszyków dzięki zautomatyzowanym kampaniom " | |
| 3617 | +#~ "kroplowym. Zacznij odzyskiwać utraconą sprzedaż w swoim sklepie " | |
| 3618 | +#~ "internetowym." | |
| 3619 | + | |
| 3620 | +#~ msgid "Save" | |
| 3621 | +#~ msgstr "uratować" | |
| 3622 | + | |
| 3623 | +#~ msgid "Save Your Progress" | |
| 3624 | +#~ msgstr "Zapisz swoje postępy" | |
| 3625 | + | |
| 3626 | +#~ msgid "Sell WooCommerce Products" | |
| 3627 | +#~ msgstr "Sprzedawaj produkty WooCommerce" | |
| 3628 | + | |
| 3629 | +#~ msgid "" | |
| 3630 | +#~ "Set a time after which auto rotation will stop. Assign in milliseconds, " | |
| 3631 | +#~ "where 1000 milliseconds = 1 second." | |
| 3632 | +#~ msgstr "" | |
| 3633 | +#~ "Ustaw czas, po którym zatrzyma się automatyczna obrót. Przypisz w " | |
| 3634 | +#~ "milisekundach, gdzie 1000 milisekund = 1 sekunda." | |
| 3635 | + | |
| 3636 | +#~ msgid "Set a Title to Your Virtual Tour" | |
| 3637 | +#~ msgstr "Ustaw tytuł na swoją wirtualną wycieczkę" | |
| 3638 | + | |
| 3639 | +#~ msgid "" | |
| 3640 | +#~ "Set a value to determine the speed of rotation. The higher the number, " | |
| 3641 | +#~ "the faster it will rotate. Positive values will make it rotate clockwise " | |
| 3642 | +#~ "and negative values will make it rotate anti clockwise" | |
| 3643 | +#~ msgstr "" | |
| 3644 | +#~ "Ustaw wartość, aby określić prędkość obrotu. Im wyższa liczba, tym " | |
| 3645 | +#~ "szybciej się obraca. Dodatnie wartości sprawią, że obróci się zgodnie z " | |
| 3646 | +#~ "ruchem wskazówek zegara, a wartości ujemne sprawią, że obróci się " | |
| 3647 | +#~ "przeciwnie do ruchu" | |
| 3648 | + | |
| 3649 | +#~ msgid "" | |
| 3650 | +#~ "Set an unique Hotspot ID to each of your Hotspots. Avoid Spaces & special " | |
| 3651 | +#~ "characters. Set it like H1 or 01" | |
| 3652 | +#~ msgstr "" | |
| 3653 | +#~ "Ustaw unikalny identyfikator hotspotu dla każdego ze swoich hotspotów. " | |
| 3654 | +#~ "Unikaj spacji i znaków specjalnych. Ustaw to jak h1 lub 01" | |
| 3655 | + | |
| 3656 | +#~ msgid "Set Contact Form" | |
| 3657 | +#~ msgstr "Ustaw formularz kontaktowy" | |
| 3658 | + | |
| 3659 | +#~ msgid "Set Hotspot ID" | |
| 3660 | +#~ msgstr "Ustaw identyfikator hotspotu" | |
| 3661 | + | |
| 3662 | +#~ msgid "Set The Content for Click Action" | |
| 3663 | +#~ msgstr "Ustaw treść dla akcji kliknięcia" | |
| 3664 | + | |
| 3665 | +#~ msgid "" | |
| 3666 | +#~ "Set the Scene ID for your first panorama image. The Scene ID has to be " | |
| 3667 | +#~ "unique for each scene and without any spaces or special characters. You " | |
| 3668 | +#~ "can set it as Scene1, S1, or simply 01." | |
| 3669 | +#~ msgstr "" | |
| 3670 | +#~ "Ustaw identyfikator sceny dla pierwszego obrazu panoramy. Identyfikator " | |
| 3671 | +#~ "sceny musi być unikalny dla każdej sceny i bez spacji i znaków " | |
| 3672 | +#~ "specjalnych. Możesz ustawić go jako Scene1, S1 lub po prostu 01." | |
| 3673 | + | |
| 3674 | +#~ msgid "Share On" | |
| 3675 | +#~ msgstr "dzielić na" | |
| 3676 | + | |
| 3677 | +#~ msgid "Starts from only" | |
| 3678 | +#~ msgstr "zaczyna się tylko od" | |
| 3679 | + | |
| 3680 | +#~ msgid "Submit" | |
| 3681 | +#~ msgstr "poddać pod" | |
| 3682 | + | |
| 3683 | +#~ msgid "Support" | |
| 3684 | +#~ msgstr "dźwigać" | |
| 3685 | + | |
| 3686 | +#~ msgid "Take The Tour" | |
| 3687 | +#~ msgstr "Weź udział w wycieczce" | |
| 3688 | + | |
| 3689 | +#~ msgid "Thank you" | |
| 3690 | +#~ msgstr "dziękuję" | |
| 3691 | + | |
| 3692 | +#~ msgid "" | |
| 3693 | +#~ "The notice will appear on the front end of the virtual tour if viewed " | |
| 3694 | +#~ "from a mobile device." | |
| 3695 | +#~ msgstr "" | |
| 3696 | +#~ "Powiadomienie pojawi się na przedniej części wirtualnej wycieczki, jeśli " | |
| 3697 | +#~ "jest oglądane z urządzenia mobilnego." | |
| 3698 | + | |
| 3699 | +#~ msgid "" | |
| 3700 | +#~ "This option will display Zoom In, Zoom Out and Full Screen buttons on the " | |
| 3701 | +#~ "tour." | |
| 3702 | +#~ msgstr "" | |
| 3703 | +#~ "Ta opcja wyświetli przyciski powiększenia, pomniejszenia i pełnego ekranu " | |
| 3704 | +#~ "podczas trasy." | |
| 3705 | + | |
| 3706 | +#~ msgid "Tour Preview Image will not appear if this is turned on." | |
| 3707 | +#~ msgstr "Obraz podglądu trasy nie pojawi się, jeśli jest włączony." | |
| 3708 | + | |
| 3709 | +#~ msgid "" | |
| 3710 | +#~ "Turning it On will display a gallery with all the scenes on your tour. By " | |
| 3711 | +#~ "double clicking on a scene thumbnail on the gallery, you can move to that " | |
| 3712 | +#~ "specific scene. The gallery will only show up on the front end and not on " | |
| 3713 | +#~ "the preview." | |
| 3714 | +#~ msgstr "" | |
| 3715 | +#~ "Włączenie go wyświetli galerię ze wszystkimi scenami podczas wycieczki. " | |
| 3716 | +#~ "Dwukrotnie klikając miniaturę sceny w galerii, możesz przejść do tej " | |
| 3717 | +#~ "konkretnej sceny. Galeria pojawi się tylko na przedniej stronie, a nie na " | |
| 3718 | +#~ "podglądzie." | |
| 3719 | + | |
| 3720 | +#~ msgid "Unlock all these options by upgrading to Premium version" | |
| 3721 | +#~ msgstr "Odblokuj wszystkie te opcje, aktualizując wersję premium" | |
| 3722 | + | |
| 3723 | +#~ msgid "Upgrade Now" | |
| 3724 | +#~ msgstr "Uaktualnij teraz" | |
| 3725 | + | |
| 3726 | +#~ msgid "Video Tutorials" | |
| 3727 | +#~ msgstr "Samouczki wideo" | |
| 3728 | + | |
| 3729 | +#~ msgid "" | |
| 3730 | +#~ "When someone clicks on the tour, auto-rotation stops. Here, set a time " | |
| 3731 | +#~ "after which auto rotation will start again. Assign in milliseconds, where " | |
| 3732 | +#~ "1000 milliseconds = 1 second." | |
| 3733 | +#~ msgstr "" | |
| 3734 | +#~ "Gdy ktoś kliknie na trasę, automatyczne obracanie zatrzymuje się. Tutaj " | |
| 3735 | +#~ "ustaw czas, po którym automatyczne obracanie rozpocznie się ponownie. " | |
| 3736 | +#~ "Przypisz w milisekundach, gdzie 1000 milisekund = 1 sekunda." | |
| 3737 | + | |
| 3738 | +#~ msgid "" | |
| 3739 | +#~ "Will activate the VR Glass support on mobile devices. This is the Beta " | |
| 3740 | +#~ "release. So, if you face any issues with it, please contact us at " | |
| 3741 | +#~ "[email protected]" | |
| 3742 | +#~ msgstr "" | |
| 3743 | +#~ "Aktywuje obsługę VR Glass na urządzeniach mobilnych. To jest wydanie " | |
| 3744 | +#~ "beta. Jeśli więc napotkasz jakiekolwiek problemy z nim, skontaktuj się z " | |
| 3745 | +#~ "nami pod adresem [email protected]" | |
| 3746 | + | |
| 3747 | +#~ msgid "" | |
| 3748 | +#~ "Will convert any jpeg or png image to webp format during media upload. " | |
| 3749 | +#~ "will decrease the image size with no quality compromise and help the site " | |
| 3750 | +#~ "to load faster." | |
| 3751 | +#~ msgstr "" | |
| 3752 | +#~ "Przekonwertuje dowolny obraz JPEG lub PNG na format WebP podczas " | |
| 3753 | +#~ "przesyłania multimediów. Zmniejszy rozmiar obrazu bez kompromisów jakości " | |
| 3754 | +#~ "i pomoże witrynie szybciej się ładować." | |
| 3755 | + | |
| 3756 | +#~ msgid "" | |
| 3757 | +#~ "WordPress's default large image handler for images larger than 2560px " | |
| 3758 | +#~ "will be disabled for WP VR. So can create virtual tours with extremely " | |
| 3759 | +#~ "high-quality images. Enabling it will also show high res image on mobile " | |
| 3760 | +#~ "devices. Many devices may not support that resolution." | |
| 3761 | +#~ msgstr "" | |
| 3762 | +#~ "Domyślna obsługa obrazów WordPress dla dużych obrazów o większych niż " | |
| 3763 | +#~ "2560 pikseli zostanie wyłączona dla WP VR. Dzięki temu można tworzyć " | |
| 3764 | +#~ "wirtualne wycieczki z niezwykle wysokiej jakości obrazami. Włączenie go " | |
| 3765 | +#~ "również wyświetli obraz w wysokiej rozdzielczości na urządzeniach " | |
| 3766 | +#~ "mobilnych. Wiele urządzeń może nie obsługiwać tej rozdzielczości." | |
| 3767 | + | |
| 3768 | +#~ msgid "" | |
| 3769 | +#~ "WP VR assets will be loaded on your allowed pages only. If you turn this " | |
| 3770 | +#~ "on, you have to list the URL's of the pages with virtual tours on the " | |
| 3771 | +#~ "'List of allowed pages to load WP VR scripts' option" | |
| 3772 | +#~ msgstr "" | |
| 3773 | +#~ "Zasoby WP VR będą ładowane tylko na dozwolonych stronach. Jeśli to " | |
| 3774 | +#~ "włączysz, musisz wyświetlić adresy URL stron z wirtualnymi wycieczkami na " | |
| 3775 | +#~ "opcji „Lista dozwolonych stron do załadowania skryptów WP VR”" | |
| 3776 | + | |
| 3777 | +#~ msgid "WP VR will not load Font Awesome library." | |
| 3778 | +#~ msgstr "WP VR nie załaduje czcionki niesamowitej biblioteki." | |
| 3779 | + | |
| 3780 | +#~ msgid "WP VR will resize each scenes for mobile devices." | |
| 3781 | +#~ msgstr "WP VR zmieni rozmiar każdej sceny na urządzenia mobilne." | |
| 3782 | + | |
| 3783 | +#~ msgid "WPFunnels" | |
| 3784 | +#~ msgstr "WPFunnele" | |
| 3785 | + | |
| 3786 | +#~ msgid "WPVR Feature Comparison" | |
| 3787 | +#~ msgstr "Porównanie funkcji WPVR" | |
| 3788 | + | |
| 3789 | +#~ msgid "Write your custom css" | |
| 3790 | +#~ msgstr "Napisz swój niestandardowy CSS" | |
| 3791 | + | |
| 3792 | +#~ msgid "" | |
| 3793 | +#~ "You can disable on hover content for mobile devices. As most of the " | |
| 3794 | +#~ "devices are touch based." | |
| 3795 | +#~ msgstr "" | |
| 3796 | +#~ "Możesz wyłączyć zawartość najechania na urządzeniach mobilnych. Ponieważ " | |
| 3797 | +#~ "większość urządzeń jest opartych na dotyku." | |
| 3798 | + | |
| 3799 | +#~ msgid "" | |
| 3800 | +#~ "You can use any image size but maximum image upload size recommended to " | |
| 3801 | +#~ "support all device is 4096x2000 px for perfect responsive view. To check " | |
| 3802 | +#~ "360 view, click on preview button and check tour preview metabox." | |
| 3803 | +#~ msgstr "" | |
| 3804 | +#~ "Możesz użyć dowolnego rozmiaru obrazu, ale maksymalny rozmiar przesyłania " | |
| 3805 | +#~ "obrazu zalecany do obsługi wszystkich urządzeń to 4096x2000 pikseli, aby " | |
| 3806 | +#~ "uzyskać doskonały responsywny widok. Aby sprawdzić widok 360, kliknij " | |
| 3807 | +#~ "przycisk Podgląd i sprawdź Metabox podglądu wycieczki." | |
| 3808 | + | |
| 3809 | +#~ msgid "Your Image In Tour Mode" | |
| 3810 | +#~ msgstr "Twój obraz w trybie wycieczki" | |
| 3811 | + | |
| 3812 | +#~ msgid "" | |
| 3813 | +#~ "Your rating and feedback matters to us. If you are happy with WP VR - 360 " | |
| 3814 | +#~ "Panorama and virtual tour creator for WordPress give us a rating." | |
| 3815 | +#~ msgstr "" | |
| 3816 | +#~ "Twoja ocena i opinie są dla nas ważne. Jeśli jesteś zadowolony z WP VR - " | |
| 3817 | +#~ "360 Panorama i Virtual Tour Creator dla WordPress, daj nam ocenę." | |
| 3818 | + | |
| 3819 | +#~ msgid "Your Viewers - And Make Them Take" | |
| 3820 | +#~ msgstr "Twoi widzowie - i spraw, aby zabrali" | |
| 3821 | + | |
| 3822 | +#~ msgid "" | |
| 3823 | +#~ "Zoom interval is 50 to 120 degree. You can put any value between 50 to " | |
| 3824 | +#~ "120. As an example, if you set 100, the scene will display with zoom in " | |
| 3825 | +#~ "100 degree on each load." | |
| 3826 | +#~ msgstr "" | |
| 3827 | +#~ "Odstęp powiększenia wynosi od 50 do 120 stopni. Możesz umieścić dowolną " | |
| 3828 | +#~ "wartość od 50 do 120. Na przykład, jeśli ustawisz 100, scena będzie " | |
| 3829 | +#~ "wyświetlana z powiększeniem w 100 stopni przy każdym obciążeniu." | |
