# wpvr/9.0.0/languages/wpvr-pl_PL.po

WPVR – 360 Panorama viewer and Virtual Tour Builder for WordPress, version 9.0.0. 3,830 lines.

- Page: https://pluginprobe.com/plugins/wpvr/9.0.0/code/languages/wpvr-pl_PL.po
- Raw: https://pluginprobe.com/plugins/wpvr/9.0.0/raw/languages/wpvr-pl_PL.po
- Modified: 2026-08-20T11:07:58+00:00

Line numbers below start at 1. Link to a line or a range by appending a fragment to the
page URL, for example `https://pluginprobe.com/plugins/wpvr/9.0.0/code/languages/wpvr-pl_PL.po#L10-L20`.

```
msgid ""
msgstr ""
"Project-Id-Version: WP VR\n"
"Report-Msgid-Bugs-To: https://wordpress.org/support/plugin/wpvr\n"
"POT-Creation-Date: 2026-08-20T04:39:59+00:00\n"
"PO-Revision-Date: 2025-08-20 07:18+0000\n"
"Last-Translator: \n"
"Language-Team: Polish\n"
"Language: pl_PL\n"
"MIME-Version: 1.0\n"
"Content-Type: text/plain; charset=UTF-8\n"
"Content-Transfer-Encoding: 8bit\n"
"Plural-Forms: nplurals=3; plural=(n==1 ? 0 : n%10 >= 2 && n%10<=4 &&(n"
"%100<10||n%100 >= 20)? 1 : 2);\n"
"X-Generator: Loco https://localise.biz/\n"
"X-Loco-Version: 2.8.0; wp-6.8.2; php-8.3.8\n"

#. Plugin Name of the plugin
#: wpvr.php
msgid "WP VR - 360 Panorama and Virtual Tour Builder"
msgstr ""

#. Plugin URI of the plugin
#: wpvr.php
msgid "https://rextheme.com/wpvr/"
msgstr "https://rextheme.com/wpvr/"

#. Description of the plugin
#: wpvr.php
#, fuzzy
msgid ""
"WP VR - 360 Panorama and virtual tour creator is a customized panaroma & "
"virtual builder tool for your website."
msgstr ""
"WP VR - 360 Panorama i Virtual Tour Creator dla WordPress to dostosowane "
"narzędzie Panaroma & Virtual Builder dla witryny WordPress."

#. Author of the plugin
#: wpvr.php
msgid "Rextheme"
msgstr "rekstemet"

#. Author URI of the plugin
#: wpvr.php
msgid "http://rextheme.com/"
msgstr "http://rextheme.com/"

#: legacy/admin/class-wpvr-admin.php:245
msgid "Write your css here"
msgstr "Napisz tutaj swój CSS tutaj"

#: legacy/admin/class-wpvr-admin.php:246
msgid ""
"Turning On The Video Option Will Erase Your Virtual Tour Data. Are You Sure?"
msgstr ""
"Włączenie opcji wideo usunie Twoje dane z wirtualnej wycieczki. Czy na pewno?"

#: legacy/admin/class-wpvr-admin.php:247
msgid ""
"Turning On The StreetView Option Will Erase Your Virtual Tour Data. Are You "
"Sure?"
msgstr ""
"Włączenie opcji StreetView spowoduje usunięcie danych z wirtualnej "
"wycieczki. Czy na pewno?"

#: legacy/admin/class-wpvr-admin.php:248
msgid "Adding Hotspots on Scene"
msgstr "Dodawanie hotspotów na scenie"

#: legacy/admin/class-wpvr-admin.php:269
msgid "Successfully Updated"
msgstr ""

#: legacy/admin/class-wpvr-admin.php:270
#, fuzzy
msgid "Importing..."
msgstr "znaczyć"

#: legacy/admin/class-wpvr-admin.php:271
#, fuzzy
msgid "Import Now"
msgstr "znaczyć"

#: legacy/admin/class-wpvr-admin.php:275
msgid "Published"
msgstr ""

#: legacy/admin/class-wpvr-admin.php:279 legacy/includes/setup-wizard.php:100
#: src/Admin/Admin.php:211 app/components/modals/ImageResizeWarningModal.jsx:78
msgid "Keep this panorama in High Resolution"
msgstr ""

#: legacy/admin/class-wpvr-admin.php:280 legacy/includes/setup-wizard.php:101
#: src/Admin/Admin.php:212 app/components/modals/ImageResizeWarningModal.jsx:94
msgid ""
"By default, a resized version is created while the original image is still "
"available."
msgstr ""

#: legacy/admin/class-wpvr-admin.php:281 legacy/includes/setup-wizard.php:102
#: src/Admin/Admin.php:213
#: app/components/modals/ImageResizeWarningModal.jsx:101
#, fuzzy
msgid "Disable WordPress Large Image Handler on WP VR for future uploads"
msgstr "Wyłącz duży program obsługi obrazów WordPress na WP VR:"

#: legacy/admin/class-wpvr-admin.php:282 legacy/includes/setup-wizard.php:103
#: src/Admin/Admin.php:214
#: app/components/modals/ImageResizeWarningModal.jsx:103
msgid "*Note: Turn this on to use the high-resolution image."
msgstr ""

#: legacy/admin/class-wpvr-admin.php:283 legacy/includes/setup-wizard.php:104
#: src/Admin/Admin.php:215 src/Admin/Admin.php:490
#: app/components/modals/CreateSceneModal.jsx:476
#: app/components/modals/ImageResizeWarningModal.jsx:86
msgid "Close"
msgstr ""

#: legacy/admin/class-wpvr-admin.php:318
msgid "Please upload a scene before proceeding to set hotspot!"
msgstr ""

#: legacy/admin/class-wpvr-admin.php:319
msgid "Negative numbers are not allowed!"
msgstr ""

#: legacy/admin/class-wpvr-admin.php:348
msgid "Setup"
msgstr "budowa ciała"

#: legacy/admin/class-wpvr-admin.php:350
msgid "Tour Preview"
msgstr "Podgląd wycieczki"

#: legacy/admin/class-wpvr-admin.php:352
msgid "Checklist"
msgstr ""

#: legacy/admin/class-wpvr-admin.php:369
#: legacy/admin/classes/class-wpvr-admin-pages.php:70
msgid "Get Started"
msgstr "rozpocząć"

#: legacy/admin/class-wpvr-admin.php:374
msgid "Documentation"
msgstr "dokumentacja"

#: legacy/admin/class-wpvr-admin.php:381
#: legacy/admin/classes/class-wpvr-admin-pages.php:104
msgid "Go Pro"
msgstr "zostać pro"

#: legacy/admin/class-wpvr-admin.php:695
#, fuzzy
msgid "Import Tour"
msgstr "znaczyć"

#: legacy/admin/class-wpvr-rollback.php:160
msgid "WP VR Plugin Rollback"
msgstr "Wtyczka WP VR Wycofanie wtyczki"

#: legacy/admin/classes/class-setup-meta-box.php:208
#: legacy/admin/classes/class-wpvr-meta-field.php:119
msgid "Video"
msgstr "wideo"

#: legacy/admin/classes/class-tour-guide-translation.php:8
msgid "Next"
msgstr "prawie"

#: legacy/admin/classes/class-tour-guide-translation.php:9
msgid "Previous"
msgstr "dawny"

#: legacy/admin/classes/class-tour-guide-translation.php:10
msgid "Done"
msgstr "spełniony"

#: legacy/admin/classes/class-tour-guide-translation.php:11
#, fuzzy
msgid "Skip Tour"
msgstr "wycieczka z przewodnikiem"

#: legacy/admin/classes/class-tour-preview-meta-box.php:169
#: legacy/admin/classes/class-tour-preview-meta-box.php:196
#: legacy/admin/classes/class-tour-preview-meta-box.php:645
msgid "Add This Position Into Active Hotspot"
msgstr ""

#: legacy/admin/classes/class-tour-preview-meta-box.php:569
msgid "PRO PREVIEW"
msgstr ""

#: legacy/admin/classes/class-tour-preview-meta-box.php:584
#: legacy/admin/classes/class-wpvr-meta-field.php:985
msgid "Scene Gallery"
msgstr "Galeria scen"

#: legacy/admin/classes/class-tour-preview-meta-box.php:593
#, fuzzy
msgid "Scene 1"
msgstr "Identyfikator scen"

#: legacy/admin/classes/class-tour-preview-meta-box.php:594
#, fuzzy
msgid "Scene 2"
msgstr "Identyfikator scen"

#: legacy/admin/classes/class-tour-preview-meta-box.php:595
#, fuzzy
msgid "Scene 3"
msgstr "Identyfikator scen"

#: legacy/admin/classes/class-tour-preview-meta-box.php:601
#, fuzzy
msgid "Background Music"
msgstr "Muzyka w tle wycieczki"

#: legacy/admin/classes/class-tour-preview-meta-box.php:606
#, fuzzy
msgid "Gyroscope — Active on mobile"
msgstr "Powiadomienia o żyroskopie i urządzeniach mobilnych"

#: legacy/admin/classes/class-tour-preview-meta-box.php:944
#: legacy/admin/classes/class-wpvr-meta-field.php:3307
msgid "Preview"
msgstr "prapremiera"

#: legacy/admin/classes/class-wpvr-admin-pages.php:73
#: legacy/admin/classes/class-wpvr-post-type.php:363
#: legacy/admin/classes/class-wpvr-post-type.php:364
msgid "Tours"
msgstr "wycieczki"

#: legacy/admin/classes/class-wpvr-admin-pages.php:75
#: legacy/admin/classes/class-wpvr-post-type.php:365
#: legacy/admin/classes/class-wpvr-post-type.php:366 src/Admin/Admin.php:58
#: src/Admin/Admin.php:234 src/Admin/Admin.php:357
msgid "Add New Tour"
msgstr "Dodaj nową wycieczkę"

#: legacy/admin/classes/class-wpvr-admin-pages.php:87
#: legacy/admin/classes/class-wpvr-meta-field.php:110
msgid "Settings"
msgstr "Ustawienie"

#: legacy/admin/classes/class-wpvr-admin-pages.php:92
#: legacy/admin/partials/wpvr_documentation.php:22
msgid "Free vs Pro"
msgstr "darmowe vs pro"

#: legacy/admin/classes/class-wpvr-admin-pages.php:95
msgid "Setup Wizard"
msgstr ""

#: legacy/admin/classes/class-wpvr-ajax.php:691
#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:635
msgid "Permission check failed"
msgstr "Sprawdzanie uprawnień nie powi"

#: legacy/admin/classes/class-wpvr-ajax.php:728
msgid "Email is required"
msgstr ""

#: legacy/admin/classes/class-wpvr-ajax.php:730
msgid "Email is invalid"
msgstr ""

#: legacy/admin/classes/class-wpvr-ajax.php:740
msgid "Contact created successfully"
msgstr ""

#: legacy/admin/classes/class-wpvr-ajax.php:742
msgid "Failed to create contact"
msgstr ""

#: legacy/admin/classes/class-wpvr-ajax.php:776
msgid "General setting data successfully saved."
msgstr ""

#: legacy/admin/classes/class-wpvr-ajax.php:821
msgid "Opt-in value saved."
msgstr ""

#. translators: %s: url to publish first tour
#: legacy/admin/classes/class-wpvr-first-tour-banner.php:112
#, php-format
msgid ""
"You haven't published your first tour yet. <a href=\"%s\">Publish your first "
"tour</a> and see it live in minutes!"
msgstr ""

#. translators: %s: url to upgrade to pro
#: legacy/admin/classes/class-wpvr-first-tour-banner.php:127
#, php-format
msgid ""
"You've published your first tour! <a href=\"%s\" target=\"_blank\" rel="
"\"noopener\">Upgrade to Pro</a> for unlimited tours, hotspots, and advanced "
"features!"
msgstr ""

#: legacy/admin/classes/class-wpvr-general.php:78
#: legacy/admin/classes/class-wpvr-shortcode.php:32
msgid "Using this Tour"
msgstr "Korzystanie z tej wycieczki"

#: legacy/admin/classes/class-wpvr-general.php:84
msgid "To Embed on External Page:"
msgstr "Aby osadzić na zewnętrznej stronie:"

#: legacy/admin/classes/class-wpvr-general.php:88
msgid "Use the iframe below to share this tour on an external page."
msgstr ""
"Użyj poniższej iframe, aby udostępnić tę wycieczkę na zewnętrznej stronie."

#: legacy/admin/classes/class-wpvr-general.php:90
msgid ""
"Note: WooCommerce &amp; Fluent Forms hotspots will not be supported on "
"embedded tours."
msgstr ""
"Uwaga: Hotspoty WooCommerce & Amp; Fluent Forms Hotspoty nie będą "
"obsługiwane podczas wycieczek osadzonych."

#: legacy/admin/classes/class-wpvr-general.php:105
msgid "Share your tour"
msgstr "Udostępnij swoją wycieczkę"

#: legacy/admin/classes/class-wpvr-general.php:110
msgid "Enable Social Media Share"
msgstr "Włącz udostępnianie w mediach społecznościowych"

#: legacy/admin/classes/class-wpvr-general.php:127
msgid "Create a tour use this QR code"
msgstr "Utwórz wycieczkę Użyj tego kodu QR"

#: legacy/admin/classes/class-wpvr-general.php:132
msgid "Download QR Code"
msgstr "pobierz kod QR"

#: legacy/admin/classes/class-wpvr-hotspot.php:109
#: legacy/admin/classes/class-wpvr-hotspot.php:169
#, fuzzy
msgid "Hotspot Settings"
msgstr "Ustawienie hotspotu"

#: legacy/admin/classes/class-wpvr-meta-field.php:92
msgid "Scenes"
msgstr "scenki"

#: legacy/admin/classes/class-wpvr-meta-field.php:101
msgid "Hotspot"
msgstr "gorący miejsce"

#: legacy/admin/classes/class-wpvr-meta-field.php:135
#: legacy/admin/classes/class-wpvr-meta-field.php:830
msgid "Floor Plan"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:147
#: legacy/admin/classes/class-wpvr-meta-field.php:839
#: legacy/admin/classes/class-wpvr-post-type.php:160
#, fuzzy
msgid "Background Tour"
msgstr "Kolor tła"

#: legacy/admin/classes/class-wpvr-meta-field.php:159
#: legacy/admin/classes/class-wpvr-meta-field.php:848
#: legacy/admin/classes/class-wpvr-post-type.php:143 src/Admin/Admin.php:556
#, fuzzy
msgid "Street View"
msgstr "Widok ulicy Google"

#: legacy/admin/classes/class-wpvr-meta-field.php:212
msgid "Set a Tour Preview Image"
msgstr "Ustaw obraz podglądu wycieczki"

#: legacy/admin/classes/class-wpvr-meta-field.php:215
msgid ""
"Upload an image that will be shown as the preview before the tour starts."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:224
msgid "Preview Image Message"
msgstr "Wyświetl wiadomość obrazkową"

#: legacy/admin/classes/class-wpvr-meta-field.php:226
msgid "Add a custom message that appears alongside the tour preview image."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:234
msgid "Tour Autoload"
msgstr "Automatyczne ładowanie wycieczki"

#: legacy/admin/classes/class-wpvr-meta-field.php:238
msgid ""
"Automatically start the tour when the page is loaded without displaying the "
"preview image."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:286
msgid "Basic Control Buttons"
msgstr "Podstawowe przyciski sterowania"

#: legacy/admin/classes/class-wpvr-meta-field.php:290
msgid ""
"Enable basic navigation buttons like play, pause, and reset for easier "
"control of the tour."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:297
msgid "Scene Fade Duration"
msgstr "Czas trwania zanikania sceny"

#: legacy/admin/classes/class-wpvr-meta-field.php:303
msgid "Set the duration (in milliseconds) for the fade effect between scenes."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:309
msgid "Auto Rotation"
msgstr "Obrót automatyczny"

#: legacy/admin/classes/class-wpvr-meta-field.php:315
msgid ""
"Enable automatic rotation of the tour for continuous movement without user "
"interaction."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:328
#, fuzzy
msgid "Control Access"
msgstr "Przyciski sterujące"

#: legacy/admin/classes/class-wpvr-meta-field.php:336
msgid "Restrict this tour to selected membership levels."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:368
msgid "Generic Form"
msgstr "Formularz ogólny"

#: legacy/admin/classes/class-wpvr-meta-field.php:375
msgid "Enable this to add a form to the tour for user interaction."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:404
msgid "Call To Action "
msgstr "wezwanie"

#: legacy/admin/classes/class-wpvr-meta-field.php:411
msgid ""
"Add a call-to-action button that prompts users to take action during the "
"tour."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:441
msgid "Custom CSS "
msgstr "Niestandardowe CSS"

#: legacy/admin/classes/class-wpvr-meta-field.php:448
msgid ""
"Add your own custom CSS styles to further personalize the look and feel of "
"the tour."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:538
msgid "Rotation Speed and Direction"
msgstr "Prędkość obrotowa i kierunek"

#: legacy/admin/classes/class-wpvr-meta-field.php:544
msgid ""
"Set the rotation speed, with positive values for anti-clockwise rotation and "
"negative values for clockwise rotation."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:550
msgid "Resume Auto-rotation after"
msgstr "Wznów automatyczne obracanie po"

#: legacy/admin/classes/class-wpvr-meta-field.php:556
msgid ""
"Define the time (in milliseconds) after which auto-rotation will resume once "
"the user clicks on the tour."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:562
msgid "Stop Auto-rotation after"
msgstr "Zatrzymaj automatyczne obracanie po"

#: legacy/admin/classes/class-wpvr-meta-field.php:568
msgid ""
"Set the time (in milliseconds) after which the auto-rotation will stop "
"automatically."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:590
msgid "Select Transition Style"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:598
msgid "This will set the scene fade effect and execution time."
msgstr "Spowoduje to ustawienie efektu zanikania sceny i czasu wykonania."

#: legacy/admin/classes/class-wpvr-meta-field.php:604
#, fuzzy
msgid "Scene Transition Duration (ms)"
msgstr "Czas trwania zanikania sceny"

#: legacy/admin/classes/class-wpvr-meta-field.php:612
msgid ""
"Set the duration for scene transition animations in milliseconds (default: "
"500 ms)."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:619
msgid "Add Animation Delay (ms)"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:628
msgid ""
"Set the delay before the scene transition animation starts (default: 0 ms)."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:640
msgid "Add Form Shortcode"
msgstr "Dodaj krótki kod formularza"

#: legacy/admin/classes/class-wpvr-meta-field.php:646
#, fuzzy
msgid "Insert the shortcode for the form you want to display in the tour."
msgstr "Wydrukuj formularze Shortcode, które chcesz wyświetlić."

#: legacy/admin/classes/class-wpvr-meta-field.php:659
msgid "Button Text"
msgstr "Tekst przycisku"

#: legacy/admin/classes/class-wpvr-meta-field.php:665
msgid "Customize the text displayed on the call-to-action button."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:671
msgid "Button URL"
msgstr "Adres URL przycisku"

#: legacy/admin/classes/class-wpvr-meta-field.php:677
msgid ""
"Set the link the call-to-action button will direct users to when clicked."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:683
msgid "Button Style"
msgstr "Styl przycisku"

#: legacy/admin/classes/class-wpvr-meta-field.php:689
msgid "Print the forms shortcode you want to show."
msgstr "Wydrukuj formularze Shortcode, które chcesz wyświetlić."

#: legacy/admin/classes/class-wpvr-meta-field.php:700
msgid "Custom CSS"
msgstr "Niestandardowe CSS"

#: legacy/admin/classes/class-wpvr-meta-field.php:826
#: legacy/admin/classes/class-wpvr-meta-field.php:835
#: legacy/admin/classes/class-wpvr-meta-field.php:844
#: legacy/admin/classes/class-wpvr-meta-field.php:853
#: legacy/admin/classes/class-wpvr-post-type.php:147
#: legacy/admin/classes/class-wpvr-post-type.php:164
#: legacy/admin/partials/wpvr_documentation.php:95
msgid "pro"
msgstr "zawodowiec"

#: legacy/admin/classes/class-wpvr-meta-field.php:857
#: legacy/admin/classes/class-wpvr-meta-field.php:870
msgid "Export"
msgstr "eksportowy"

#: legacy/admin/classes/class-wpvr-meta-field.php:894
msgid "Keyboard Movement Control"
msgstr "Kontrola ruchu klawiatury"

#: legacy/admin/classes/class-wpvr-meta-field.php:898
msgid "Use arrow keys or WASD keys to move through the virtual tour."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:905
msgid "Keyboard Zoom Control"
msgstr "Kontrola zoomu klawiatury"

#: legacy/admin/classes/class-wpvr-meta-field.php:909
msgid "Zoom in and out of the virtual tour using keyboard shortcuts."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:916
msgid "Mouse Drag Control"
msgstr "Kontrola przeciągania myszy"

#: legacy/admin/classes/class-wpvr-meta-field.php:920
msgid ""
"Click and drag with your mouse to look around and navigate the virtual tour."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:927
msgid "Mouse Zoom Control"
msgstr "Kontrola zoomu myszy"

#: legacy/admin/classes/class-wpvr-meta-field.php:931
msgid ""
"Use your mouse wheel to zoom in and out smoothly within the virtual tour."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:938
msgid "Gyroscope Control"
msgstr "Sterowanie żyroskopem"

#: legacy/admin/classes/class-wpvr-meta-field.php:942
msgid ""
"Move your mobile device to explore the tour using built-in motion sensors."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:949
msgid "Auto Gyroscope Support"
msgstr "Obsługa żyroskopu samochodowego"

#: legacy/admin/classes/class-wpvr-meta-field.php:953
msgid ""
"Automatically activate device orientation control if enabled, or manually "
"trigger it with a button."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:960
msgid "Compass"
msgstr "opasanie"

#: legacy/admin/classes/class-wpvr-meta-field.php:964
msgid ""
"Display a directional guide to keep track of your orientation while "
"navigating the virtual tour."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:990
msgid ""
"Show a gallery of all scenes, allowing users to easily navigate by clicking "
"on thumbnails."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:996
msgid "Scene Titles on Gallery"
msgstr "Tytuły scen w galerii"

#: legacy/admin/classes/class-wpvr-meta-field.php:1001
#, fuzzy
msgid ""
"Display scene titles on each thumbnail in the Scene Gallery for better "
"identification."
msgstr ""
"Włączenie go spowoduje wyświetlenie tytułów scen na każdej miniaturze sceny "
"w galerii sceny. Identyfikatory scen będą używane jako tytuł sceny."

#: legacy/admin/classes/class-wpvr-meta-field.php:1007
msgid "Scene Navigation Menu"
msgstr "Menu nawigacji sceny"

#: legacy/admin/classes/class-wpvr-meta-field.php:1012
msgid ""
"Enable a menu to navigate through all scenes, allowing users to jump to a "
"specific scene."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1018
msgid "Tour Background Music"
msgstr "Muzyka w tle wycieczki"

#: legacy/admin/classes/class-wpvr-meta-field.php:1023
msgid "Add background music to your tour to enhance the user experience."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1029
msgid "Enable explainer video"
msgstr "Włącz wideo wyjaśniające"

#: legacy/admin/classes/class-wpvr-meta-field.php:1033
msgid ""
"Add an explainer video to the tour, providing additional context or details "
"for users."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1040
msgid "Set Zoom Preferences"
msgstr "Ustaw preferencje powiększenia"

#: legacy/admin/classes/class-wpvr-meta-field.php:1044
msgid ""
"Customize the zoom level for your tour, with options to adjust the view "
"between 50 to 120 degrees."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1051
msgid "Add Company Information"
msgstr "Dodaj informacje o firmie"

#: legacy/admin/classes/class-wpvr-meta-field.php:1056
msgid ""
"Include your company logo and details within the tour to brand the "
"experience."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1078
#: legacy/admin/classes/class-wpvr-meta-field.php:1148
msgid "Scene Type"
msgstr "Typ sceny"

#: legacy/admin/classes/class-wpvr-meta-field.php:1085
#: legacy/admin/classes/class-wpvr-meta-field.php:1155
msgid "Choose the type of scene, such as Equirectangular or Cubemap."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1091
#: legacy/admin/classes/class-wpvr-meta-field.php:1160
msgid "Scene Upload"
msgstr "Przesyłanie sceny"

#: legacy/admin/classes/class-wpvr-meta-field.php:1097
#: legacy/admin/classes/class-wpvr-meta-field.php:1166
#: legacy/admin/classes/class-wpvr-meta-field.php:2275
msgid "Upload an image to be used as the scene media (video is not supported)."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1103
#: legacy/admin/classes/class-wpvr-meta-field.php:1172
msgid "Set as Default"
msgstr "Ustaw jako domyślny"

#: legacy/admin/classes/class-wpvr-meta-field.php:1109
#: legacy/admin/classes/class-wpvr-meta-field.php:1178
msgid "Make this scene the first one that appears when the tour loads."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1115
#: legacy/admin/classes/class-wpvr-meta-field.php:1184
msgid "Scene ID"
msgstr "Identyfikator scen"

#: legacy/admin/classes/class-wpvr-meta-field.php:1122
#: legacy/admin/classes/class-wpvr-meta-field.php:1191
msgid "Unique identifier for the scene, auto-generated if left empty."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1211
msgid "Hotspot ID"
msgstr "Identyfikator hotspotu"

#: legacy/admin/classes/class-wpvr-meta-field.php:1218
msgid "A unique identifier for the hotspot, auto-generated if left empty."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1224
msgid "Pitch"
msgstr "wystawiać towar"

#: legacy/admin/classes/class-wpvr-meta-field.php:1231
msgid "Set the pitch angle for the hotspot’s vertical position in the scene."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1236
msgid "Yaw"
msgstr "schodzić z kursu"

#: legacy/admin/classes/class-wpvr-meta-field.php:1243
msgid "Set the yaw angle for the hotspot’s horizontal position in the scene."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1248
msgid "Hotspot Custom Icon Class"
msgstr "Niestandardowa klasa ikon Hotspot"

#: legacy/admin/classes/class-wpvr-meta-field.php:1255
msgid "Add a custom CSS class for the hotspot icon."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1274
#: legacy/admin/classes/class-wpvr-meta-field.php:1360
#: legacy/admin/classes/class-wpvr-meta-field.php:1452
#: legacy/admin/classes/class-wpvr-meta-field.php:1518
#: legacy/admin/classes/class-wpvr-meta-field.php:1584
msgid "Hotspot-Type"
msgstr "Hotspot-typ"

#: legacy/admin/classes/class-wpvr-meta-field.php:1278
#: legacy/admin/classes/class-wpvr-meta-field.php:1364
#: legacy/admin/classes/class-wpvr-meta-field.php:1462
#: legacy/admin/classes/class-wpvr-meta-field.php:1528
#: legacy/admin/classes/class-wpvr-meta-field.php:1588
msgid "URL"
msgstr "URL"

#: legacy/admin/classes/class-wpvr-meta-field.php:1284
#: legacy/admin/classes/class-wpvr-meta-field.php:1370
msgid "Provide a URL that the hotspot will link to when clicked."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1289
#: legacy/admin/classes/class-wpvr-meta-field.php:1375
#: legacy/admin/classes/class-wpvr-meta-field.php:1468
#: legacy/admin/classes/class-wpvr-meta-field.php:1534
#: legacy/admin/classes/class-wpvr-meta-field.php:1594
msgid "Open in same tab"
msgstr "Otwórz w tej samej karcie"

#: legacy/admin/classes/class-wpvr-meta-field.php:1295
#: legacy/admin/classes/class-wpvr-meta-field.php:1381
msgid "Choose whether the URL opens in the same tab or a new tab."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1301
#: legacy/admin/classes/class-wpvr-meta-field.php:1387
#: legacy/admin/classes/class-wpvr-meta-field.php:1475
#: legacy/admin/classes/class-wpvr-meta-field.php:1541
#: legacy/admin/classes/class-wpvr-meta-field.php:1601
msgid "On Click Content"
msgstr "Przy kliknięciu treści"

#: legacy/admin/classes/class-wpvr-meta-field.php:1305
#: legacy/admin/classes/class-wpvr-meta-field.php:1393
msgid "Add custom content or actions that occur when the hotspot is clicked."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1311
#: legacy/admin/classes/class-wpvr-meta-field.php:1399
#: legacy/admin/classes/class-wpvr-meta-field.php:1482
#: legacy/admin/classes/class-wpvr-meta-field.php:1548
#: legacy/admin/classes/class-wpvr-meta-field.php:1607
msgid "On Hover Content"
msgstr "Na najechaniu zawartości"

#: legacy/admin/classes/class-wpvr-meta-field.php:1315
#: legacy/admin/classes/class-wpvr-meta-field.php:1405
msgid ""
"Add custom content or actions that appear when the user hovers over the "
"hotspot."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1320
#: legacy/admin/classes/class-wpvr-meta-field.php:1410
#: legacy/admin/classes/class-wpvr-meta-field.php:1488
#: legacy/admin/classes/class-wpvr-meta-field.php:1554
#: legacy/admin/classes/class-wpvr-meta-field.php:1613
msgid "Select Target Scene from List"
msgstr "Wybierz scenę docelową z listy"

#: legacy/admin/classes/class-wpvr-meta-field.php:1324
#: legacy/admin/classes/class-wpvr-meta-field.php:1415
msgid "Choose the target scene for the hotspot to navigate to."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1329
#: legacy/admin/classes/class-wpvr-meta-field.php:1420
#: legacy/admin/classes/class-wpvr-meta-field.php:1493
#: legacy/admin/classes/class-wpvr-meta-field.php:1559
#: legacy/admin/classes/class-wpvr-meta-field.php:1618
msgid "Target Scene ID"
msgstr "Identyfikator sceny docelowe"

#: legacy/admin/classes/class-wpvr-meta-field.php:1336
#: legacy/admin/classes/class-wpvr-meta-field.php:1427
msgid "Provide the unique ID of the target scene."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1456
#: legacy/admin/classes/class-wpvr-meta-field.php:1522
msgid "Select your form"
msgstr "Wybierz swój formularz"

#: legacy/admin/classes/class-wpvr-meta-field.php:1646
msgid "Basic Settings"
msgstr "Podstawowe ustawienia"

#: legacy/admin/classes/class-wpvr-meta-field.php:1655
msgid "Advanced Controls"
msgstr "Zaawansowane sterowanie"

#: legacy/admin/classes/class-wpvr-meta-field.php:1700
msgid "Documentation "
msgstr "dokumentacja"

#: legacy/admin/classes/class-wpvr-meta-field.php:1918
#, fuzzy
msgid "Video Tour"
msgstr "wycieczka z przewodnikiem"

#: legacy/admin/classes/class-wpvr-meta-field.php:1938
msgid "Enable or disable video mode using self-hosted, YouTube, or Vimeo."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:1945
msgid "Upload or Add Link"
msgstr "Prześlij lub dodaj link"

#: legacy/admin/classes/class-wpvr-meta-field.php:1946
msgid "Paste Youtube or Vimeo link or upload"
msgstr "Wklej link do YouTube lub Vimeo lub prześlij"

#: legacy/admin/classes/class-wpvr-meta-field.php:1952
msgid "Use a self-hosted file or paste a YouTube/Vimeo link."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:2010
#: legacy/admin/classes/class-wpvr-meta-field.php:2062
#: legacy/admin/classes/class-wpvr-meta-field.php:2116
#: legacy/admin/classes/class-wpvr-meta-field.php:2158
#: legacy/admin/classes/class-wpvr-meta-field.php:2207
#: legacy/admin/classes/class-wpvr-meta-field.php:2282
#: legacy/admin/classes/class-wpvr-meta-field.php:2338
#: legacy/admin/classes/class-wpvr-meta-field.php:2397
#: legacy/admin/classes/class-wpvr-meta-field.php:2457
#: legacy/admin/classes/class-wpvr-meta-field.php:2514
#: legacy/admin/classes/class-wpvr-meta-field.php:2571
#: legacy/admin/classes/class-wpvr-meta-field.php:2628
#: legacy/admin/classes/class-wpvr-meta-field.php:2704
#: legacy/admin/classes/class-wpvr-meta-field.php:2856
#: legacy/admin/classes/class-wpvr-meta-field.php:2999
#: legacy/admin/classes/class-wpvr-meta-field.php:3065
#: legacy/admin/classes/class-wpvr-meta-field.php:3119
#: legacy/admin/classes/class-wpvr-meta-field.php:3180
#: legacy/admin/classes/class-wpvr-meta-field.php:3230
#: legacy/admin/classes/class-wpvr-meta-field.php:3284
#: legacy/admin/classes/class-wpvr-meta-field.php:3332
#: legacy/admin/classes/class-wpvr-meta-field.php:3418
#: legacy/admin/classes/class-wpvr-meta-field.php:3470
#: legacy/admin/classes/class-wpvr-meta-field.php:3524
#: legacy/admin/classes/class-wpvr-meta-field.php:3580
#: legacy/admin/classes/class-wpvr-meta-field.php:3630
#: legacy/admin/classes/class-wpvr-meta-field.php:3678
#: legacy/admin/classes/class-wpvr-meta-field.php:3767
#: legacy/admin/classes/class-wpvr-meta-field.php:3819
#: legacy/admin/classes/class-wpvr-meta-field.php:3870
#: legacy/admin/classes/class-wpvr-meta-field.php:3973
#: legacy/admin/classes/class-wpvr-meta-field.php:4025
#: legacy/admin/classes/class-wpvr-meta-field.php:4077
#: legacy/admin/classes/class-wpvr-meta-field.php:4123
#: legacy/admin/classes/class-wpvr-meta-field.php:4181
#: legacy/admin/classes/class-wpvr-meta-field.php:4225
#: legacy/admin/classes/class-wpvr-meta-field.php:4270
#: legacy/admin/classes/class-wpvr-meta-field.php:4315
#: legacy/admin/classes/class-wpvr-meta-field.php:4426
#: legacy/admin/classes/class-wpvr-meta-field.php:4474
#: legacy/admin/classes/class-wpvr-meta-field.php:4571
#: legacy/admin/classes/class-wpvr-meta-field.php:4644
#: legacy/admin/classes/class-wpvr-meta-field.php:5005
#: legacy/admin/classes/class-wpvr-meta-field.php:5057
#: legacy/admin/classes/class-wpvr-meta-field.php:5157
#: legacy/admin/classes/class-wpvr-meta-field.php:5257
#: legacy/admin/classes/class-wpvr-meta-field.php:5374
#: legacy/admin/classes/class-wpvr-meta-field.php:5487
#: legacy/admin/classes/class-wpvr-meta-field.php:5593
#: legacy/admin/classes/class-wpvr-meta-field.php:5705
#: legacy/admin/classes/class-wpvr-meta-field.php:5812
#: legacy/includes/class-wpvr.php:356
msgid "View Doc"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:2021
#: legacy/admin/partials/wpvr-review-request-body-content.php:6
#: legacy/admin/partials/wpvr_confirmation_alert.php:30
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:173
msgid "Yes"
msgstr "ba"

#: legacy/admin/classes/class-wpvr-meta-field.php:2022
#: legacy/admin/partials/wpvr_confirmation_alert.php:27
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:174
msgid "No"
msgstr "bynajm"

#: legacy/admin/classes/class-wpvr-meta-field.php:2073
msgid "Equirectangular"
msgstr "równowartościowy"

#: legacy/admin/classes/class-wpvr-meta-field.php:2074
msgid "Cubemap"
msgstr "Mapa słowna"

#: legacy/admin/classes/class-wpvr-meta-field.php:2270
#, fuzzy
msgid "Scene Upload:"
msgstr "Przesyłanie sceny:"

#: legacy/admin/classes/class-wpvr-meta-field.php:2772
#, fuzzy
msgid "Upload"
msgstr "Przesyłanie sceny"

#: legacy/admin/classes/class-wpvr-meta-field.php:2797
msgid ""
"You can add any logo size. But recommended size is below 100x100 px for "
"perfect look."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:2816
msgid "Company Details : "
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:2939
#: legacy/admin/classes/class-wpvr-meta-field.php:4707
#: legacy/admin/classes/class-wpvr-meta-field.php:4717
#: legacy/admin/classes/class-wpvr-meta-field.php:4819
msgid "Color"
msgstr "zafarb"

#: legacy/admin/classes/class-wpvr-meta-field.php:2946
msgid "Icon"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:3018
#, fuzzy
msgid "Upload icon"
msgstr "Prześlij lub dodaj link"

#: legacy/admin/classes/class-wpvr-meta-field.php:3020
msgid "Click to"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:3020
#, fuzzy
msgid "Upload an Image"
msgstr "Prześlij obraz panoramy"

#: legacy/admin/classes/class-wpvr-meta-field.php:3025
msgid "This option will not work if the \"Tour Autoload\" is turned on."
msgstr "Ta opcja nie zadziała, jeśli włączono „Tour Autoload”."

#: legacy/admin/classes/class-wpvr-meta-field.php:3354
msgid "Classic Layout"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:3367
msgid "Modern Layout"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:3659
#: legacy/admin/classes/class-wpvr-meta-field.php:3712
#: legacy/admin/classes/class-wpvr-meta-field.php:4455
#: legacy/admin/classes/class-wpvr-meta-field.php:4516
msgid "Info"
msgstr "info"

#: legacy/admin/classes/class-wpvr-meta-field.php:3660
#: legacy/admin/classes/class-wpvr-meta-field.php:3713
#: legacy/admin/classes/class-wpvr-meta-field.php:4456
#: legacy/admin/classes/class-wpvr-meta-field.php:4517
#, fuzzy
msgid "Scene"
msgstr "scenki"

#: legacy/admin/classes/class-wpvr-meta-field.php:3671
#: legacy/admin/classes/class-wpvr-meta-field.php:4467
msgid ""
"Choose the type of hotspot: Info (displays information) or Scene (links to "
"another scene)."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:3860
msgid "Tooltip Icon"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4116
msgid "Select a custom icon for the hotspot."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4174
msgid "Set a custom background color for the hotspot."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4218
msgid "Set a custom color for the hotspot icon."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4263
msgid "Enable an animation for the hotspot."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4308
msgid ""
"Add a border around the hotspot with customizable color, style, and "
"thickness."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4419
msgid "Select the shape of the hotspot (e.g., Rounded, square, and Hexagon)."
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4698
msgid "Open in new tab"
msgstr "Otwórz w nowej karcie"

#: legacy/admin/classes/class-wpvr-meta-field.php:4705
#, fuzzy
msgid "Background Color :"
msgstr "Kolor tła"

#: legacy/admin/classes/class-wpvr-meta-field.php:4714
#, fuzzy
msgid "Font color :"
msgstr "kolor czcionki"

#: legacy/admin/classes/class-wpvr-meta-field.php:4724
#, fuzzy
msgid "Font Size (px) :"
msgstr "Rozmiar czcionki (PX)"

#: legacy/admin/classes/class-wpvr-meta-field.php:4729
#, fuzzy
msgid "Font Weight :"
msgstr "Waga czcion"

#: legacy/admin/classes/class-wpvr-meta-field.php:4741
#, fuzzy
msgid "Line Height :"
msgstr "Wysokość linii"

#: legacy/admin/classes/class-wpvr-meta-field.php:4746
#, fuzzy
msgid "Text Decoration :"
msgstr "Dekoracja tekstu"

#: legacy/admin/classes/class-wpvr-meta-field.php:4748
#: legacy/admin/classes/class-wpvr-meta-field.php:4758
#: legacy/admin/classes/class-wpvr-meta-field.php:4933
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:41 legacy/src/index.js:41
#: legacy/src/index.js:72
msgid "None"
msgstr "żaden"

#: legacy/admin/classes/class-wpvr-meta-field.php:4749
msgid "Underline"
msgstr "uwydatniać"

#: legacy/admin/classes/class-wpvr-meta-field.php:4750
msgid "Overline"
msgstr "wyciąć"

#: legacy/admin/classes/class-wpvr-meta-field.php:4751
msgid "Line Through"
msgstr "przejechać"

#: legacy/admin/classes/class-wpvr-meta-field.php:4756
#, fuzzy
msgid "Text Transform :"
msgstr "Przekształć tekst"

#: legacy/admin/classes/class-wpvr-meta-field.php:4759
msgid "Uppercase"
msgstr "wielkie litery"

#: legacy/admin/classes/class-wpvr-meta-field.php:4760
msgid "Lowercase"
msgstr "małe litery"

#: legacy/admin/classes/class-wpvr-meta-field.php:4761
msgid "Capitalize"
msgstr "spieniężać"

#: legacy/admin/classes/class-wpvr-meta-field.php:4766
#, fuzzy
msgid "Button Alignment :"
msgstr "Wyrównanie przycisków"

#: legacy/admin/classes/class-wpvr-meta-field.php:4768
#: legacy/admin/classes/class-wpvr-meta-field.php:4846
msgid "Left"
msgstr "lewo"

#: legacy/admin/classes/class-wpvr-meta-field.php:4769
#: legacy/admin/classes/class-wpvr-meta-field.php:4836
msgid "Right"
msgstr "w porządku"

#: legacy/admin/classes/class-wpvr-meta-field.php:4770
msgid "Center"
msgstr "skupisko"

#: legacy/admin/classes/class-wpvr-meta-field.php:4771
msgid "Justified"
msgstr "usprawiedliwiony"

#: legacy/admin/classes/class-wpvr-meta-field.php:4776
#, fuzzy
msgid "Font Style :"
msgstr "Styl czcionki"

#: legacy/admin/classes/class-wpvr-meta-field.php:4778
msgid "Normal"
msgstr "normalny"

#: legacy/admin/classes/class-wpvr-meta-field.php:4779
msgid "Italic"
msgstr "italski"

#: legacy/admin/classes/class-wpvr-meta-field.php:4780
msgid "Oblique"
msgstr "skośny"

#: legacy/admin/classes/class-wpvr-meta-field.php:4785
#, fuzzy
msgid "Letter Spacing (px) :"
msgstr "Rozstaw liter (PX)"

#: legacy/admin/classes/class-wpvr-meta-field.php:4790
#, fuzzy
msgid "Word Spacing (px) :"
msgstr "Odstępy słów (PX)"

#: legacy/admin/classes/class-wpvr-meta-field.php:4795
#, fuzzy
msgid "Border Radius (px) :"
msgstr "Promień granicy (PX)"

#: legacy/admin/classes/class-wpvr-meta-field.php:4800
#, fuzzy
msgid "Border :"
msgstr "okalać"

#: legacy/admin/classes/class-wpvr-meta-field.php:4803
msgid "Width (px)"
msgstr "Szerokość (Px)"

#: legacy/admin/classes/class-wpvr-meta-field.php:4808
msgid "Style"
msgstr "wskazówka zegar"

#: legacy/admin/classes/class-wpvr-meta-field.php:4828
#, fuzzy
msgid "Padding (px) :"
msgstr "Wyściółka (PX)"

#: legacy/admin/classes/class-wpvr-meta-field.php:4831
msgid "Top"
msgstr "buda woz"

#: legacy/admin/classes/class-wpvr-meta-field.php:4841
msgid "Bottom"
msgstr "spód"

#: legacy/admin/classes/class-wpvr-meta-field.php:4934
msgid "Circle Crop"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4936
msgid "Zoom In"
msgstr "pomakżyć"

#: legacy/admin/classes/class-wpvr-meta-field.php:4937
#, fuzzy
msgid "Zoom In Up"
msgstr "pomakżyć"

#: legacy/admin/classes/class-wpvr-meta-field.php:4938
#, fuzzy
msgid "Zoom In Down"
msgstr "pomakżyć"

#: legacy/admin/classes/class-wpvr-meta-field.php:4939
#, fuzzy
msgid "Zoom In Left"
msgstr "pomakżyć"

#: legacy/admin/classes/class-wpvr-meta-field.php:4940
#, fuzzy
msgid "Zoom In Right"
msgstr "pomakżyć"

#: legacy/admin/classes/class-wpvr-meta-field.php:4942
msgid "Slide In Up"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4943
msgid "Slide In Down"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4944
msgid "Slide In Left"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4945
msgid "Slide In Right"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4947
msgid "Fade With Blur"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4948
msgid "Fade In"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4949
msgid "Fade In Up"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4950
msgid "Fade In Down"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4951
msgid "Fade In Left"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4952
#, fuzzy
msgid "Fade In Right"
msgstr "Ruszaj w prawo"

#: legacy/admin/classes/class-wpvr-meta-field.php:4953
msgid "Fade In Top Left"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4954
msgid "Fade In Top Right"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4955
msgid "Fade In Bottom Left"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4956
msgid "Fade In Bottom Right"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4958
msgid "Back In Left"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4959
msgid "Back In Right"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4960
msgid "Back In Up"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4961
msgid "Back In Down"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4963
msgid "Bounce In"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4964
msgid "Bounce In Up"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4965
#, fuzzy
msgid "Bounce In Down"
msgstr "opuszczać"

#: legacy/admin/classes/class-wpvr-meta-field.php:4966
#, fuzzy
msgid "Bounce In Left"
msgstr "Przesuń się w lewo"

#: legacy/admin/classes/class-wpvr-meta-field.php:4967
#, fuzzy
msgid "Bounce In Right"
msgstr "Ruszaj w prawo"

#: legacy/admin/classes/class-wpvr-meta-field.php:4969
msgid "Flip"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4970
msgid "Flip X"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4971
msgid "Flip Y"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4973
msgid "Light Speed In Left"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4974
msgid "Light Speed In Right"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4976
msgid "Rotate In"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4977
msgid "Rotate In Up Left"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4978
msgid "Rotate In Up Right"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4979
msgid "Rotate In Down Left"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:4980
msgid "Rotate In Down Right"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:5034
msgid "All Membership Levels"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:5789
msgid "Large"
msgstr ""

#: legacy/admin/classes/class-wpvr-meta-field.php:5790
msgid "Small"
msgstr ""

#: legacy/admin/classes/class-wpvr-occasion-banner.php:120
msgid "4th of july special offer logo"
msgstr ""

#: legacy/admin/classes/class-wpvr-occasion-banner.php:124
msgid "Biggest sale of the year!"
msgstr ""

#: legacy/admin/classes/class-wpvr-occasion-banner.php:128
msgid "4th of july special discount"
msgstr ""

#: legacy/admin/classes/class-wpvr-occasion-banner.php:133
msgid "Offer Countdown"
msgstr ""

#: legacy/admin/classes/class-wpvr-occasion-banner.php:152
msgid "Click to view 4th of july sale products"
msgstr ""

#: legacy/admin/classes/class-wpvr-occasion-banner.php:154
msgid "Get The Deal"
msgstr ""

#: legacy/admin/classes/class-wpvr-onboarding-notice.php:288
msgid ""
"You haven't created a virtual tour yet. Our quick setup wizard will help you "
"publish your first tour in minutes!"
msgstr ""

#: legacy/admin/classes/class-wpvr-onboarding-notice.php:293
msgid "Start setup wizard"
msgstr ""

#: legacy/admin/classes/class-wpvr-onboarding-notice.php:300
#: src/Admin/UiModeSwitcher.php:134
msgid "Dismiss this notice"
msgstr ""

#: legacy/admin/classes/class-wpvr-onboarding-notice.php:301
msgid "Dismiss"
msgstr ""

#: legacy/admin/classes/class-wpvr-post-type.php:98
#: legacy/admin/classes/class-wpvr-post-type.php:184
msgid "Create Tour"
msgstr ""

#: legacy/admin/classes/class-wpvr-post-type.php:107
#, fuzzy
msgid "Select your preferred tour"
msgstr "Wybierz swój formularz"

#: legacy/admin/classes/class-wpvr-post-type.php:117
msgid "360 Image Tour"
msgstr ""

#: legacy/admin/classes/class-wpvr-post-type.php:128
#, fuzzy
msgid "360 Video Tour"
msgstr "Wsparcie wideo 360"

#: legacy/admin/classes/class-wpvr-post-type.php:174 src/Admin/Admin.php:497
msgid "Tour Name"
msgstr ""

#: legacy/admin/classes/class-wpvr-post-type.php:182
#: legacy/admin/partials/wpvr-setup-wizard-views.php:198
#: src/Admin/Admin.php:568 app/components/modals/CreateSceneModal.jsx:638
msgid "Cancel"
msgstr ""

#: legacy/admin/classes/class-wpvr-post-type.php:367 src/Admin/Admin.php:57
#: src/Admin/Admin.php:234 src/Admin/Admin.php:357
#, fuzzy
msgid "Edit Tour"
msgstr "koniec wycieczki"

#: legacy/admin/classes/class-wpvr-post-type.php:368
#: src/Api/Services/TourService.php:244
#, fuzzy
msgid "New Tour"
msgstr "Dodaj nową wycieczkę"

#: legacy/admin/classes/class-wpvr-post-type.php:369
#, fuzzy
msgid "View Tour"
msgstr "wycieczka z przewodnikiem"

#: legacy/admin/classes/class-wpvr-post-type.php:370
#, fuzzy
msgid "Search WP VR Tour"
msgstr "Identyfikator trasy WPVR"

#: legacy/admin/classes/class-wpvr-post-type.php:371
#, fuzzy
msgid "No WP VR Tour found"
msgstr "Identyfikator trasy WPVR"

#: legacy/admin/classes/class-wpvr-post-type.php:372
msgid "No WP VR Tour found in Trash"
msgstr ""

#: legacy/admin/classes/class-wpvr-post-type.php:374
#, fuzzy
msgid "All Tours"
msgstr "wycieczki"

#: legacy/admin/classes/class-wpvr-post-type.php:375
#: legacy/oxygen/WPVR_OXY_INTEGRATION.php:38
msgid "WP VR"
msgstr "WP VR"

#: legacy/admin/classes/class-wpvr-post-type.php:428
#, fuzzy
msgid "Title"
msgstr "Tytuł sceny"

#: legacy/admin/classes/class-wpvr-post-type.php:429
msgid "Tour Thumbnail"
msgstr ""

#: legacy/admin/classes/class-wpvr-post-type.php:430
#, fuzzy
msgid "Shortcode"
msgstr "Dodaj krótki kod formularza"

#: legacy/admin/classes/class-wpvr-post-type.php:431 src/Admin/Admin.php:514
msgid "Tour Type"
msgstr ""

#: legacy/admin/classes/class-wpvr-post-type.php:432
msgid "Author"
msgstr ""

#: legacy/admin/classes/class-wpvr-post-type.php:433
msgid "Date"
msgstr ""

#: legacy/admin/classes/class-wpvr-post-type.php:597
#: legacy/admin/classes/class-wpvr-post-type.php:598
msgid "WP VR item updated."
msgstr ""

#: legacy/admin/classes/class-wpvr-sample-tour.php:75
msgid "Failed to initialize WP_Filesystem"
msgstr ""

#: legacy/admin/classes/class-wpvr-scene.php:232
#: legacy/admin/classes/class-wpvr-scene.php:261
#, fuzzy
msgid "Scene Settings"
msgstr "Ustawienie sceny"

#: legacy/admin/classes/class-wpvr-scene.php:672
#: legacy/bricks/Wpvr-widget.php:186
msgid "Bricks Editor Mode - WPVR Preview is not available."
msgstr ""

#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:82
msgid "Close banner"
msgstr ""

#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:108
msgid "Eid Mubarak, Save Big"
msgstr ""

#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:113
msgid "Up to 50% Off"
msgstr ""

#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:145
msgid "Claim Your Deal on Eid-Ul-Fitr"
msgstr ""

#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:146
msgid "Claim Your Deal"
msgstr ""

#: legacy/admin/classes/class-wpvr-shortcode.php:36
msgid "For Classic Editor:"
msgstr "Dla klasycznego edytora:"

#: legacy/admin/classes/class-wpvr-shortcode.php:39
msgid ""
"To use this WP VR tour in your posts or pages use the following shortcode "
msgstr ""
"Aby użyć tego WP VR Tour w swoich postach lub stronach, użyj następującego "
"skrótu kodu"

#: legacy/admin/classes/class-wpvr-video.php:46
msgid "Video Settings : "
msgstr "Ustawienia wideo:"

#: legacy/admin/classes/class-wpvr-video.php:93
#: legacy/admin/classes/class-wpvr-video.php:152
msgid "panoid"
msgstr ""

#: legacy/admin/classes/class-wpvr-video.php:94
msgid "panoviddata"
msgstr ""

#: legacy/admin/classes/class-wpvr-video.php:95
#: legacy/admin/classes/class-wpvr-video.php:152
msgid "vidid"
msgstr ""

#: legacy/admin/classes/class-wpvr-video.php:96
msgid "vidurl"
msgstr ""

#: legacy/admin/classes/class-wpvr-video.php:97
#: legacy/admin/classes/class-wpvr-video.php:152
msgid "vidtype"
msgstr ""

#: legacy/admin/classes/class-wpvr-video.php:98
msgid "autoplay"
msgstr ""

#: legacy/admin/classes/class-wpvr-video.php:99
msgid "loop"
msgstr ""

#: legacy/admin/classes/class-wpvr-video.php:152
msgid "panodata"
msgstr ""

#: legacy/admin/partials/wpvr-premium-feature-popup.php:54
#: legacy/admin/partials/wpvr_confirmation_alert.php:510
#, fuzzy
msgid "This is a Premium Feature"
msgstr "Funkcje premium"

#: legacy/admin/partials/wpvr-premium-feature-popup.php:58
#: legacy/admin/partials/wpvr_confirmation_alert.php:514
msgid "Upgrade to Pro to unlock this and start using the feature."
msgstr ""

#. translators: %s: Discount price
#: legacy/admin/partials/wpvr-premium-feature-popup.php:83
#: legacy/admin/partials/wpvr_confirmation_alert.php:539
#, php-format
msgid "Starting at %s/year"
msgstr ""

#. translators: %s: Original price
#: legacy/admin/partials/wpvr-premium-feature-popup.php:87
#: legacy/admin/partials/wpvr_confirmation_alert.php:543
#, php-format
msgid "Normally %s/year"
msgstr ""

#: legacy/admin/partials/wpvr-premium-feature-popup.php:94
#: legacy/admin/partials/wpvr_confirmation_alert.php:550
#, fuzzy
msgid "Upgrade to PRO Now"
msgstr "Uaktualnij do Pro"

#: legacy/admin/partials/wpvr-review-request-body-content.php:4
msgid ""
"Hey, I noticed you've made nice tour with WP VR! Are you enjoying WP VR?"
msgstr ""

#: legacy/admin/partials/wpvr-review-request-body-content.php:7
msgid "Not Really"
msgstr ""

#: legacy/admin/partials/wpvr-review-request-body-content.php:18
msgid ""
"That's awesome! Could you please do me a BIG favor and give it a rating on "
"WordPress to help us grow and motivate us?"
msgstr ""

#: legacy/admin/partials/wpvr-review-request-body-content.php:18
msgid "Lincoln Islam"
msgstr ""

#: legacy/admin/partials/wpvr-review-request-body-content.php:21
msgid "Already given"
msgstr ""

#: legacy/admin/partials/wpvr-review-request-body-content.php:22
msgid "No thanks"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:17
#, fuzzy
msgid "WP VR - Setup Wizard"
msgstr "Konfiguracja WPVR"

#: legacy/admin/partials/wpvr-setup-wizard-views.php:35
msgid "Remind me later"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:56
msgid "What are you creating a virtual tour for?"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:57
msgid "We'll set things up with the right template for you."
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:62
msgid "Real Estate"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:63
msgid "Show property without a visit"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:67
msgid "Hotels & Resorts"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:68
msgid "Experience before booking"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:72
msgid "Educational Institutions"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:73
msgid "Campus tours & admissions"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:77
msgid "E-commerce"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:78
msgid "Virtual shopping experience"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:82
msgid "Exhibitions"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:83
msgid "Art & gallery showcases"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:87
msgid "Offices"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:88
msgid "Virtual office tours"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:92
msgid "Showrooms"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:93
msgid "Virtual showroom experiences"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:98
msgid "Skip — I'll upload my own image"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:112
msgid "Show your property without another site visit"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:113
msgid "Most agents publish their first property tour in minutes."
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:121
msgid "Upload my own 360 photo"
msgstr ""

#. translators: %s: link to browse
#: legacy/admin/partials/wpvr-setup-wizard-views.php:127
#, php-format
msgid "Drag & drop your 360° image or %s"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:128
msgid "click to browse"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:136
msgid "Supported files: JPEG, PNG, WebP"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:141
msgid "USE PROPERTY TEMPLATE"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:148
#: legacy/admin/partials/wpvr-setup-wizard-views.php:208
msgid "Back"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:159
msgid "This is how buyers will experience your listing"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:160
msgid "Interactive, immersive, and accessible on any device."
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:166
#: legacy/admin/partials/wpvr-setup-wizard-views.php:173
msgid "Drag to rotate"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:167
#: legacy/admin/partials/wpvr-setup-wizard-views.php:174
msgid "Scroll to zoom"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:168
#, fuzzy
msgid "Click to add hotspot"
msgstr "Dodajmy hotspot"

#: legacy/admin/partials/wpvr-setup-wizard-views.php:191
#: legacy/admin/partials/wpvr-setup-wizard-views.php:199
#, fuzzy
msgid "Add Hotspot"
msgstr "gorący miejsce"

#: legacy/admin/partials/wpvr-setup-wizard-views.php:195
#, fuzzy
msgid "Hotspot Text"
msgstr "Hotspot-typ"

#: legacy/admin/partials/wpvr-setup-wizard-views.php:196
msgid "Enter information about this location..."
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:211
#, fuzzy
msgid "Publish Tour"
msgstr "Opublikuj swoją wycieczkę"

#: legacy/admin/partials/wpvr-setup-wizard-views.php:221
msgid "Your tour is published!"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:222
msgid ""
"Your virtual tour has been created and is ready to be displayed on your "
"website."
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:229
#, fuzzy
msgid "Edit Your Tour"
msgstr "Zapisz swoją wycieczkę"

#: legacy/admin/partials/wpvr-setup-wizard-views.php:237
msgid "I agree to share non-sensitive diagnostic data to help improve WP VR."
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:238
msgid "(You can change this in WP VR settings anytime)"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:244
msgid "Start Over"
msgstr ""

#: legacy/admin/partials/wpvr-setup-wizard-views.php:246
msgid "Go to listing"
msgstr ""

#: legacy/admin/partials/wpvr_checklist_template.php:16
#, fuzzy
msgid "Add at least one scene"
msgstr "Dodawanie hotspotów na scenie"

#: legacy/admin/partials/wpvr_checklist_template.php:27
msgid "Upload your first 360° image or video."
msgstr ""

#: legacy/admin/partials/wpvr_checklist_template.php:36
msgid "Upload 360° media"
msgstr ""

#: legacy/admin/partials/wpvr_checklist_template.php:47
msgid "Ensure media is self-hosted or from YouTube/Vimeo."
msgstr ""

#: legacy/admin/partials/wpvr_checklist_template.php:56
#, fuzzy
msgid "Set a default scene"
msgstr "Ustaw jako domyślny"

#: legacy/admin/partials/wpvr_checklist_template.php:67
msgid "Choose where users will start the tour."
msgstr ""

#: legacy/admin/partials/wpvr_checklist_template.php:76
msgid "Add navigation hotspots"
msgstr ""

#: legacy/admin/partials/wpvr_checklist_template.php:87
msgid "Link different scenes or add interactive elements."
msgstr ""

#: legacy/admin/partials/wpvr_checklist_template.php:96
msgid "Enable basic controls"
msgstr ""

#: legacy/admin/partials/wpvr_checklist_template.php:107
msgid "Allow movement within the tour."
msgstr ""

#: legacy/admin/partials/wpvr_checklist_template.php:116
#, fuzzy
msgid "Enable zoom controls"
msgstr "Włącz lub wyłącz kontrolę zoomu myszy."

#: legacy/admin/partials/wpvr_checklist_template.php:127
msgid "Allow zooming within the tour."
msgstr ""

#: legacy/admin/partials/wpvr_checklist_template.php:137
#, fuzzy
msgid "Publish the tour"
msgstr "Opublikuj swoją wycieczkę"

#: legacy/admin/partials/wpvr_checklist_template.php:148
msgid "Publish your tour and embed it anywhere on your site."
msgstr ""

#: legacy/admin/partials/wpvr_confirmation_alert.php:426
#, fuzzy
msgid "Layout Settings"
msgstr "Ustawienie"

#: legacy/admin/partials/wpvr_confirmation_alert.php:431
#, fuzzy
msgid "Icon background Color:"
msgstr "Kolor tła"

#: legacy/admin/partials/wpvr_confirmation_alert.php:441
#, fuzzy
msgid "Icon Color:"
msgstr "Kolor tła"

#: legacy/admin/partials/wpvr_confirmation_alert.php:452
#, fuzzy
msgid "Apply Style"
msgstr "wskazówka zegar"

#: legacy/admin/partials/wpvr_documentation.php:33
msgid "Unlimited Scenes (Up to 5 in Free)"
msgstr "Nieograniczone sceny (do 5 w darmowym)"

#: legacy/admin/partials/wpvr_documentation.php:34
msgid "Unlimited Hotspots (Up to to 5 for a scene in free)"
msgstr "Nieograniczone hotspoty (do 5 za scenę za darmo)"

#: legacy/admin/partials/wpvr_documentation.php:35
msgid "Publish Tours Anywhere (Embed Add-on)"
msgstr "Publikuj wycieczki w dowolnym miejscu (dodatk do osadzenia)"

#: legacy/admin/partials/wpvr_documentation.php:36
msgid "WooCommerce Add-on"
msgstr "Dodatek WooCommerce"

#: legacy/admin/partials/wpvr_documentation.php:37
msgid "Gyroscope Support"
msgstr "Wsparcie żyroskopu"

#: legacy/admin/partials/wpvr_documentation.php:38
msgid "Panorama Scene Gallery"
msgstr "Galeria scen panoramicznych"

#: legacy/admin/partials/wpvr_documentation.php:39
msgid "Explainer Video"
msgstr "Wyjaśnienie wideo"

#: legacy/admin/partials/wpvr_documentation.php:40
msgid "Tour Background Audio"
msgstr "Wycieczka dźwięk w tle"

#: legacy/admin/partials/wpvr_documentation.php:41
msgid "Info-type Hotspots (Heading, Image, Text, Video, Gif, Links)"
msgstr "Hotspoty typu info (nagłówek, obraz, tekst, wideo, GIF, linki)"

#: legacy/admin/partials/wpvr_documentation.php:42
msgid "Scene-type Hotspots (Connect Panoramas)"
msgstr "Hotspoty typu sceny (Połącz panoramy)"

#: legacy/admin/partials/wpvr_documentation.php:43
msgid "Custom Icon & Color for Hotspots (Using CSS)"
msgstr "Niestandardowa ikona i kolor dla hotspotów (przy użyciu CSS)"

#: legacy/admin/partials/wpvr_documentation.php:44
msgid "900+ Icons & RGB Color Support for Hotspots"
msgstr "900+ ikon i obsługa kolorów RGB dla hotspotów"

#: legacy/admin/partials/wpvr_documentation.php:45
msgid "Partial Panorama / Mobile Panorama Support"
msgstr "Częściowa Panorama / Mobilna Panorama Wsparcie"

#: legacy/admin/partials/wpvr_documentation.php:46
msgid "360 Video Support"
msgstr "Wsparcie wideo 360"

#: legacy/admin/partials/wpvr_documentation.php:47
msgid "Google Street View"
msgstr "Widok ulicy Google"

#: legacy/admin/partials/wpvr_documentation.php:48
msgid "Cubemap Image Support"
msgstr "Obsługa obrazów CubeMap"

#: legacy/admin/partials/wpvr_documentation.php:49
msgid "VR Glass Support for Video Tours"
msgstr "Wsparcie VR Glass dla wideour wycieczek"

#: legacy/admin/partials/wpvr_documentation.php:50
msgid "Fluent Forms Add-on"
msgstr "Dodatek Fluent Forms"

#: legacy/admin/partials/wpvr_documentation.php:51
msgid "Autoload Tours"
msgstr "Wycieczki z automatycznym ładowaniem"

#: legacy/admin/partials/wpvr_documentation.php:52
msgid "Custom Rotation Settings"
msgstr "Niestandardowe ustawienia rotacji"

#: legacy/admin/partials/wpvr_documentation.php:53
msgid "Full Page Virtual Tours"
msgstr "Wirtualne wycieczki na całej stronie"

#: legacy/admin/partials/wpvr_documentation.php:54
msgid "Custom Preview Image & Text"
msgstr "Niestandardowy obraz podglądu i tekst"

#: legacy/admin/partials/wpvr_documentation.php:55
msgid "Company Logo & Description"
msgstr "Logo firmy i opis"

#: legacy/admin/partials/wpvr_documentation.php:56
msgid "Import & Export Virtual Tours"
msgstr "Import i eksport wirtualne wycieczki"

#: legacy/admin/partials/wpvr_documentation.php:57
msgid "Duplicate Tours with One Click"
msgstr "Powiel wycieczki za jednym kliknięciem"

#: legacy/admin/partials/wpvr_documentation.php:58
msgid "Control Horizontal & Vertical View of Panorama Images"
msgstr "Kontroluj poziomy i pionowy widok obrazów panoramicznych"

#: legacy/admin/partials/wpvr_documentation.php:59
msgid "Custom Zoom Settings"
msgstr "Niestandardowe ustawienia powiększenia"

#: legacy/admin/partials/wpvr_documentation.php:60
msgid "Custom Panorama Loading Face"
msgstr "Niestandardowa twarz ładująca panoramę"

#: legacy/admin/partials/wpvr_documentation.php:61
msgid "Background Panoramas"
msgstr "Panoramy w tle"

#: legacy/admin/partials/wpvr_documentation.php:62
msgid "Home Button to visit Default Scene"
msgstr "Przycisk Home, aby odwiedzić domyślną scenę"

#: legacy/admin/partials/wpvr_documentation.php:63
msgid "Scene Title"
msgstr "Tytuł sceny"

#: legacy/admin/partials/wpvr_documentation.php:64
msgid "Scene Author with URL"
msgstr "Autor sceny z adresem URL"

#: legacy/admin/partials/wpvr_documentation.php:65
msgid "Enable or Disable Keyboard Movement Control."
msgstr "Włącz lub wyłącz kontrolę ruchu klawiatury."

#: legacy/admin/partials/wpvr_documentation.php:66
msgid "Enable or Disable Keyboard Zoom Control."
msgstr "Włącz lub wyłącz kontrolę zoomu klawiatury."

#: legacy/admin/partials/wpvr_documentation.php:67
msgid "Enable or Disable Mouse Drag Control."
msgstr "Włącz lub wyłącz kontrolę przeciągania myszy."

#: legacy/admin/partials/wpvr_documentation.php:68
msgid "Enable or Disable Mouse Zoom control."
msgstr "Włącz lub wyłącz kontrolę zoomu myszy."

#: legacy/admin/partials/wpvr_documentation.php:69
msgid "Mouse Control."
msgstr "Kontrola myszy."

#: legacy/admin/partials/wpvr_documentation.php:70
msgid "On Screen Compass."
msgstr "Kompas na ekranie."

#: legacy/admin/partials/wpvr_documentation.php:71
msgid "Scene Titles on Gallery."
msgstr "Tytuły scen w galerii."

#: legacy/admin/partials/wpvr_documentation.php:72
msgid "Customize Icon & Logo of Control Buttons."
msgstr "Dostosuj ikonę i logo przycisków sterowania."

#: legacy/admin/partials/wpvr_documentation.php:73
msgid "Autoload & Autoplay Video Tours."
msgstr "Automatyczne ładowanie i autoodtwarzanie wideo."

#: legacy/admin/partials/wpvr_documentation.php:93
msgid "features"
msgstr "zarzut"

#: legacy/admin/partials/wpvr_documentation.php:94
msgid "free"
msgstr "bezpłatny"

#: legacy/admin/partials/wpvr_documentation.php:115
#: legacy/admin/partials/wpvr_documentation.php:116 wpvr.php:426
msgid "Upgrade to Pro"
msgstr "Uaktualnij do Pro"

#: legacy/admin/partials/wpvr_license.php:18
msgid "License Key"
msgstr "klucz licencyjny"

#: legacy/admin/partials/wpvr_license.php:22
msgid "Enter your license key, save changes and activate."
msgstr "Wprowadź klucz licencyjny, zapisz zmiany i aktywuj."

#: legacy/admin/partials/wpvr_license.php:28
#: legacy/admin/partials/wpvr_license.php:38
msgid "Activate License"
msgstr "Aktywuj licencję"

#: legacy/admin/partials/wpvr_license.php:32
msgid "Active"
msgstr ""

#: legacy/admin/partials/wpvr_license.php:34
msgid "Deactivate License"
msgstr "Dezaktywuj licencję"

#: legacy/admin/partials/wpvr_setting.php:97
#: legacy/admin/partials/wpvr_setting.php:104
#, fuzzy
msgid "General Settings"
msgstr "Ogólne opcje konfiguracji"

#: legacy/admin/partials/wpvr_setting.php:106
#, fuzzy
msgid "Setup Options"
msgstr "Ogólne opcje konfiguracji"

#: legacy/admin/partials/wpvr_setting.php:131
msgid ""
"Allow the Editors of your site to Create, Edit, Update, and Delete virtual "
"tours (They can access other users' tours):"
msgstr ""
"Zezwól redaktorom Twojej witryny na tworzenie, edycję, aktualizację i "
"usuwanie wirtualnych wycieczek (mogą uzyskać dostęp do wycieczek innych "
"użytkowników):"

#. translators: %s: documentation url
#: legacy/admin/partials/wpvr_setting.php:159
#, php-format
msgid ""
"Enable editors to manage all virtual tours on your site, including those "
"created by other users. <a href=\"%s\" target=\"_blank\" rel=\"noopener "
"noreferrer\">View Doc</a>"
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:174
msgid ""
"Allow the Authors of your site to Create, Edit, Update, and Delete virtual "
"tours (They can access their own tours only):"
msgstr ""
"Zezwól autorom Twojej witryny na tworzenie, edycję, aktualizację i usuwanie "
"wirtualnych wycieczek (mogą uzyskać dostęp tylko do własnych wycieczek):"

#. translators: %s: documentation url
#: legacy/admin/partials/wpvr_setting.php:201
#, php-format
msgid ""
"Grant authors permission to manage only their own virtual tours without "
"accessing others' tours. <a href=\"%s\" target=\"_blank\" rel=\"noopener "
"noreferrer\">View Doc</a>"
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:216
#, fuzzy
msgid ""
"Allow Dokan Vendors of your site to Create, Edit, Update, and Delete virtual "
"tours (They can access their own tours only):"
msgstr ""
"Zezwól autorom Twojej witryny na tworzenie, edycję, aktualizację i usuwanie "
"wirtualnych wycieczek (mogą uzyskać dostęp tylko do własnych wycieczek):"

#: legacy/admin/partials/wpvr_setting.php:238
#, fuzzy
msgid ""
"Dokan vendor will be able to Create, Edit, Update, and Delete their own "
"virtual tours only."
msgstr ""
"Autorzy będą mogli tworzyć, edytować, aktualizować i usuwać tylko własne "
"wirtualne wycieczki."

#: legacy/admin/partials/wpvr_setting.php:246
msgid "Disable Fontawesome from WP VR:"
msgstr "Wyłącz FontaWesome z WP VR:"

#. translators: %s: documentation url
#: legacy/admin/partials/wpvr_setting.php:274
#, php-format
msgid ""
"Turn off the Fontawesome icon library in WP VR if you prefer to use custom "
"icons or other icon libraries. <a href=\"%s\" target=\"_blank\" rel="
"\"noopener noreferrer\">View Doc</a>"
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:288
msgid "Enable mobile media resizer:"
msgstr "Włącz zmianę rozmiaru nośników mobilnych:"

#: legacy/admin/partials/wpvr_setting.php:310
msgid ""
" Automatically adjust media sizes for mobile devices to ensure optimal "
"viewing performance."
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:316
msgid "Disable WordPress Large Image Handler on WP VR:"
msgstr "Wyłącz duży program obsługi obrazów WordPress na WP VR:"

#. translators: %s: documentation url
#: legacy/admin/partials/wpvr_setting.php:344
#, php-format
msgid ""
"Prevent WordPress from resizing large images, keeping the original size for "
"better quality in tours. <a href=\"%s\" target=\"_blank\" rel=\"noopener "
"noreferrer\">View Doc</a>"
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:360
msgid "Disable On Hover Content for Mobile:"
msgstr "Wyłącz zawartość najechania na telefon komórkowy:"

#. translators: %s: documentation url
#: legacy/admin/partials/wpvr_setting.php:388
#, php-format
msgid ""
"Turn off hover-based content interactions on mobile devices to enhance "
"usability on touch screens. <a href=\"%s\" target=\"_blank\" rel=\"noopener "
"noreferrer\">View Doc</a>"
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:402
msgid "Enable Mobile Hotspot Tip:"
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:415
msgid ""
"When enabled, a tip message is shown to mobile visitors after their first "
"interaction with the virtual tour."
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:421
msgid ""
"Enable script control (It will load the WP VR scripts on the pages with "
"virtual tours only):"
msgstr ""
"Włącz kontrolę skryptów (załaduje skrypty WP VR na stronach tylko z "
"wirtualnymi wycieczkami):"

#. translators: %s: documentation url
#: legacy/admin/partials/wpvr_setting.php:449
#, php-format
msgid ""
"Load WP VR scripts only on pages with virtual tours, improving page load "
"times on other pages. <a href=\"%s\" target=\"_blank\" rel=\"noopener "
"noreferrer\">View Doc</a>"
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:463
msgid ""
"List of allowed pages to load WP VR scripts (The URLs of the pages on your "
"site with virtual tours):"
msgstr ""
"Lista dozwolonych stron do załadowania skryptów WP VR (adresy URL stron w "
"Twojej witrynie z wirtualnymi wycieczkami):"

#: legacy/admin/partials/wpvr_setting.php:468
msgid ""
"List the pages with virtual tours like this: https://example.com/tour1/, "
"https://example.com/tour2/"
msgstr ""
"Wymień strony z wirtualnymi wycieczkami w następujący sposób: https://"
"example.com/tour1/, https://example.com/tour2/"

#: legacy/admin/partials/wpvr_setting.php:475
#, fuzzy
msgid ""
"Video Tour JS control (It will load the WP VR Video JS library in the listed "
"pages only):"
msgstr ""
"Włącz kontrolę wideo JS (załaduje bibliotekę WP VR Video JS tylko na "
"wymienionych stronach):"

#. translators: %s: documentation url
#: legacy/admin/partials/wpvr_setting.php:503
#, php-format
msgid ""
"Activate the Video.js library only on pages that contain virtual video "
"tours, optimizing resources. <a href=\"%s\" target=\"_blank\" rel=\"noopener "
"noreferrer\">View Doc</a>"
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:517
msgid ""
"List of allowed pages to load WP VR Video JS library (The URLs of the pages "
"on your site, You want to load Video JS):"
msgstr ""
"Lista dozwolonych stron do załadowania biblioteki WP VR Video JS (adresy URL "
"stron w Twojej witrynie, chcesz załadować wideo JS):"

#: legacy/admin/partials/wpvr_setting.php:522
msgid ""
"List the pages like this: https://example.com/tour1/, https://example.com/"
"tour2/"
msgstr ""
"Wymień strony w następujący sposób: https://example.com/tour1/, https://"
"example.com/tour2/"

#: legacy/admin/partials/wpvr_setting.php:535
msgid "Flip the phone to landscape mode for a better experience of the tour."
msgstr "Przesuń telefon w tryb poziomy, aby uzyskać lepsze wrażenia z trasy."

#: legacy/admin/partials/wpvr_setting.php:539
msgid "Front-End Notice for Mobile Visitors:"
msgstr "Powiadomienie z front-end dla użytkowników mobilnych:"

#: legacy/admin/partials/wpvr_setting.php:561
msgid ""
"Display a message on the front end to inform mobile visitors about virtual "
"tour capabilities or requirements."
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:569
msgid "VR GLass Support:"
msgstr "Wsparcie szkła VR:"

#. translators: %s: documentation url
#: legacy/admin/partials/wpvr_setting.php:607
#, php-format
msgid ""
"Enable compatibility with VR glasses for immersive viewing of virtual tours "
"on supported devices. <a href=\"%s\" target=\"_blank\" rel=\"noopener "
"noreferrer\">View Doc</a>"
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:621
#, fuzzy
msgid "Convert any jpeg or png format image to WebP on media upload:"
msgstr ""
"Konwertuj dowolny obraz w formacie JPEG lub PNG na WebP podczas przesyłania "
"multimediów:"

#: legacy/admin/partials/wpvr_setting.php:657
msgid ""
"Automatically convert JPEG or PNG images to the WebP format when uploading, "
"improving load times and image quality."
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:666
msgid "Allow Usage Data Sharing:"
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:678
msgid ""
"Share your site URL, email, and anonymous usage data to help us improve WP "
"VR. You can disable this at any time."
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:686
msgid "Select a Version to Rollback"
msgstr "Wybierz wersję do wycofania"

#: legacy/admin/partials/wpvr_setting.php:708
msgid "Succesfully Saved"
msgstr ""

#: legacy/admin/partials/wpvr_setting.php:712
#, fuzzy
msgid "Reset Defaults"
msgstr "Ustaw jako domyślny"

#: legacy/admin/partials/wpvr_setting.php:716
#, fuzzy
msgid "Save Settings"
msgstr "Ustawienie sceny"

#: legacy/bricks/bricks.php:65 legacy/bricks/Wpvr-widget.php:76
#: legacy/bricks/Wpvr-widget.php:90 legacy/bricks/Wpvr-widget.php:96
#: legacy/builders/wpbakery/wpvr-element.php:44
#: legacy/elementor/elements/Wpvr-widget.php:43
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:60
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:66
msgid "WPVR"
msgstr "WPVR"

#: legacy/bricks/Wpvr-widget.php:130
#: legacy/builders/wpbakery/wpvr-element.php:53
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:128
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:51 legacy/src/index.js:134
#, fuzzy
msgid "Select Tour"
msgstr "Wybierz swój formularz"

#: legacy/bricks/Wpvr-widget.php:140
#, fuzzy
msgid "Width(px)"
msgstr "Szerokość (Px)"

#: legacy/bricks/Wpvr-widget.php:144
#, fuzzy
msgid "Height(px)"
msgstr "zenit"

#: legacy/bricks/Wpvr-widget.php:148
#, fuzzy
msgid "Radius(px)"
msgstr "promień"

#: legacy/bricks/Wpvr-widget.php:194
msgid "No tour has been selected."
msgstr ""

#: legacy/builders/wpbakery/wpvr-element.php:26
#, fuzzy
msgid "Select a tour"
msgstr "Wybierz swój formularz"

#: legacy/builders/wpbakery/wpvr-element.php:42
#, fuzzy
msgid "WPVR - Virtual Tour"
msgstr "Wirtualne wycieczki na całej stronie"

#: legacy/builders/wpbakery/wpvr-element.php:46
msgid "Embed a WPVR virtual tour with full analytics and tracking support."
msgstr ""

#: legacy/builders/wpbakery/wpvr-element.php:62
msgid "Width (number only)"
msgstr ""

#: legacy/builders/wpbakery/wpvr-element.php:70
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:152
msgid "Width Unit"
msgstr "Szerokość Jednostka"

#: legacy/builders/wpbakery/wpvr-element.php:84
msgid "Height (number only)"
msgstr ""

#: legacy/builders/wpbakery/wpvr-element.php:92
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:193
msgid "Height Unit"
msgstr "Wysokość"

#: legacy/builders/wpbakery/wpvr-element.php:104
#, fuzzy
msgid "Mobile Height (number only)"
msgstr "Mobilna jednostka wysokości"

#: legacy/builders/wpbakery/wpvr-element.php:112
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:215
msgid "Mobile Height Unit"
msgstr "Mobilna jednostka wysokości"

#: legacy/elementor/elements/Wpvr-widget.php:145
msgid "WPVR Setup"
msgstr "Konfiguracja WPVR"

#: legacy/elementor/elements/Wpvr-widget.php:156
#, fuzzy
msgid "Select Tour:"
msgstr "Wybierz swój formularz"

#: legacy/elementor/elements/Wpvr-widget.php:165
msgid "Width:"
msgstr "Szerokość:"

#: legacy/elementor/elements/Wpvr-widget.php:168
#: legacy/elementor/elements/Wpvr-widget.php:178
#: legacy/elementor/elements/Wpvr-widget.php:188
#: legacy/elementor/elements/Wpvr-widget.php:197
#, fuzzy
msgid "Put value in PX"
msgstr "Wpisz wartość w (px)"

#: legacy/elementor/elements/Wpvr-widget.php:175
msgid "Height:"
msgstr "Wysokość:"

#: legacy/elementor/elements/Wpvr-widget.php:185
msgid "Radius:"
msgstr "Promień:"

#: legacy/elementor/elements/Wpvr-widget.php:195 legacy/src/index.js:240
msgid "Mobile Height"
msgstr "Wysokość mobilna"

#: legacy/includes/class-wpvr-linno-telemetry.php:480
msgid "Setup / Interface is too complex"
msgstr ""

#: legacy/includes/class-wpvr-linno-telemetry.php:481
msgid "What was the biggest blocker?"
msgstr ""

#: legacy/includes/class-wpvr-linno-telemetry.php:486
msgid "Missing specific VR feature"
msgstr ""

#: legacy/includes/class-wpvr-linno-telemetry.php:487
msgid "Which feature? (Floor Plan, WebVR, etc.)"
msgstr ""

#: legacy/includes/class-wpvr-linno-telemetry.php:492
msgid "Tour not displaying / Error"
msgstr ""

#: legacy/includes/class-wpvr-linno-telemetry.php:493
msgid "Any error message or URL?"
msgstr ""

#: legacy/includes/class-wpvr-linno-telemetry.php:498
msgid "Image quality / Performance issues"
msgstr ""

#: legacy/includes/class-wpvr-linno-telemetry.php:499
msgid "Image size or browser details help."
msgstr ""

#: legacy/includes/class-wpvr-linno-telemetry.php:504
msgid "Found a better solution"
msgstr ""

#: legacy/includes/class-wpvr-linno-telemetry.php:505
msgid "Which tool? What did it do better?"
msgstr ""

#: legacy/includes/class-wpvr-linno-telemetry.php:510
msgid "Just testing / One-time project"
msgstr ""

#: legacy/includes/class-wpvr-linno-telemetry.php:511
msgid "What were you building?"
msgstr ""

#: legacy/includes/class-wpvr.php:246
#, fuzzy
msgid "Floor Plan Settings : "
msgstr "Ustawienia wideo:"

#: legacy/includes/class-wpvr.php:253
msgid "Enable Floor Plan: "
msgstr ""

#. translators: %s: documentation url
#: legacy/includes/class-wpvr.php:268
#, php-format
msgid ""
"Activate the floor plan view for your virtual tour. <a href=\"%s\" target="
"\"_blank\" rel=\"noopener noreferrer\">View Doc</a>"
msgstr ""

#: legacy/includes/class-wpvr.php:296
#, fuzzy
msgid "Background Tour Settings : "
msgstr "Ustawienia wideo:"

#: legacy/includes/class-wpvr.php:302
#, fuzzy
msgid "Enable Background Tour: "
msgstr "Kolor tła"

#. translators: %s: documentation url
#: legacy/includes/class-wpvr.php:317
#, php-format
msgid ""
"When enabled, a title and subtitle will appear at the top of the tour. <a "
"href=\"%s\" target=\"_blank\" rel=\"noopener noreferrer\">View Doc</a>"
msgstr ""

#: legacy/includes/class-wpvr.php:343
#, fuzzy
msgid "Embed Google Street View : "
msgstr "Widok ulicy Google"

#: legacy/includes/class-wpvr.php:347
#, fuzzy
msgid "Enable Street View:"
msgstr "Widok ulicy Google"

#: legacy/includes/class-wpvr.php:352
msgid "Insert a Street View iframe link."
msgstr ""

#: legacy/includes/class-wpvr.php:388
#, fuzzy
msgid "Export Tour : "
msgstr "Importuj plik wycieczki:"

#: legacy/includes/class-wpvr.php:389
#, fuzzy
msgid "Download"
msgstr "pobierz kod QR"

#: legacy/includes/setup-wizard.php:109
msgid "Limit Reached"
msgstr ""

#. translators: %d: maximum number of hotspots allowed in free version
#: legacy/includes/setup-wizard.php:111
#, php-format
msgid "You can add up to %d hotspots on each scene in the Free version."
msgstr ""

#: legacy/includes/setup-wizard.php:112
msgid "Upgrade to Pro to add an unlimited number of hotspots."
msgstr ""

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:129
msgid "WPVR Tour ID"
msgstr "Identyfikator trasy WPVR"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:140
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:59 legacy/src/index.js:141
#, fuzzy
msgid "Tour Width"
msgstr "szerokość"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:141
msgid "WPVR Width"
msgstr "Szerokość WPVR"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:151
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:67
#, fuzzy
msgid "Tour Width Unit"
msgstr "Szerokość Jednostka"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:155
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:196
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:218
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:240
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:71
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:103
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:122
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:141
msgid "px"
msgstr "ermodrale"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:156
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:72
msgid "%"
msgstr "prokuratura"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:157
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:73
msgid "vw"
msgstr "VW"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:169
#, fuzzy
msgid "Tour Fullwidth"
msgstr "pełna szerokość"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:170
#: legacy/src/index.js:53
msgid "Fullwidth"
msgstr "pełna szerokość"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:184
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:92 legacy/src/index.js:157
#, fuzzy
msgid "Tour Height"
msgstr "zenit"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:185
msgid "WPVR Height"
msgstr "Wysokość WPVR"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:192
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:99
#, fuzzy
msgid "Tour Height Unit"
msgstr "Wysokość"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:197
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:104
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:123
msgid "vh"
msgstr "ves"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:206
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:111 legacy/src/index.js:172
#, fuzzy
msgid "Tour Mobile Height"
msgstr "Wysokość mobilna"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:207
msgid "WPVR Mobile Height"
msgstr "Wysokość mobilna WPVR"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:214
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:118
#, fuzzy
msgid "Tour Mobile Height Unit"
msgstr "Mobilna jednostka wysokości"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:228
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:130
#, fuzzy
msgid "Tour Radius"
msgstr "promień"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:229
msgid "WPVR Radius"
msgstr "Promień WPVR"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:236
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:137
#, fuzzy
msgid "Tour Radius Unit"
msgstr "Jednostka promienia"

#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:237
msgid "Radius Unit"
msgstr "Jednostka promienia"

#: legacy/oxygen/elements/Wpvr_Tour_Element.php:22
#, fuzzy
msgid "WP VR Tour"
msgstr "Identyfikator trasy WPVR"

#: legacy/oxygen/elements/Wpvr_Tour_Element.php:44
msgid "No title"
msgstr ""

#: legacy/oxygen/elements/Wpvr_Tour_Element.php:80
#, fuzzy
msgid "Tour Width Fullwidth"
msgstr "szerokość pełna szerokość"

#: legacy/oxygen/elements/Wpvr_Tour_Element.php:84
msgid "OFF"
msgstr "opodal"

#: legacy/oxygen/elements/Wpvr_Tour_Element.php:85
msgid "ON"
msgstr "przez"

#: legacy/oxygen/elements/Wpvr_Tour_Element.php:114
msgid "Height on mobile devices. Leave empty to use the main height."
msgstr ""

#: legacy/oxygen/elements/Wpvr_Tour_Element.php:159
msgid "Please select a WP VR Tour from the dropdown in the sidebar."
msgstr ""

#: legacy/oxygen/WPVR_OXY_INTEGRATION.php:32
msgid "Build with WP VR"
msgstr ""

#: legacy/public/class-wpvr-public.php:200
#, fuzzy
msgid "Virtual tour"
msgstr "Wirtualne wycieczki na całej stronie"

#: legacy/public/class-wpvr-public.php:201
msgid ""
"Use the arrow keys or W, A, S, and D to look around. Use Tab to reach tour "
"controls and hotspots."
msgstr ""

#: legacy/public/class-wpvr-public.php:202
#, fuzzy
msgid "Load virtual tour"
msgstr "dla nieograniczonej wirtualnej wycieczki."

#: legacy/public/class-wpvr-public.php:203
#, fuzzy
msgid "Tour hotspot"
msgstr "gorący miejsce"

#: legacy/public/class-wpvr-public.php:204
msgid "View scene"
msgstr ""

#: legacy/public/class-wpvr-public.php:205
#, fuzzy
msgid "Scene menu"
msgstr "Typ sceny"

#: legacy/public/class-wpvr-public.php:206
#, fuzzy
msgid "Previous scene"
msgstr "dawny"

#: legacy/public/class-wpvr-public.php:207
msgid "Next scene"
msgstr ""

#: legacy/public/class-wpvr-public.php:208
msgid "Look up"
msgstr ""

#: legacy/public/class-wpvr-public.php:209
msgid "Look down"
msgstr ""

#: legacy/public/class-wpvr-public.php:210
msgid "Look left"
msgstr ""

#: legacy/public/class-wpvr-public.php:211
#, fuzzy
msgid "Look right"
msgstr "Ruszaj w prawo"

#: legacy/public/class-wpvr-public.php:212
#, fuzzy
msgid "Zoom in"
msgstr "pomakżyć"

#: legacy/public/class-wpvr-public.php:213
#, fuzzy
msgid "Zoom out"
msgstr "pomniejszyć"

#: legacy/public/class-wpvr-public.php:214
msgid "Toggle fullscreen"
msgstr ""

#: legacy/public/class-wpvr-public.php:215
msgid "Return to starting scene"
msgstr ""

#: legacy/public/class-wpvr-public.php:216
#, fuzzy
msgid "Toggle device orientation"
msgstr "Dekoracja tekstu"

#: legacy/public/class-wpvr-public.php:217
msgid "Toggle tour audio"
msgstr ""

#: legacy/public/class-wpvr-public.php:218
#, fuzzy
msgid "Toggle scene gallery"
msgstr "Galeria scen"

#: legacy/public/class-wpvr-public.php:219
msgid "Open tour video"
msgstr ""

#: legacy/public/class-wpvr-public.php:220
msgid "Open form"
msgstr ""

#: legacy/public/class-wpvr-public.php:221
msgid "Open floor plan"
msgstr ""

#: legacy/public/class-wpvr-public.php:222
msgid "View scene from floor plan"
msgstr ""

#: legacy/public/class-wpvr-public.php:223
#, fuzzy
msgid "Company information"
msgstr "Dodaj informacje o firmie"

#: legacy/public/class-wpvr-public.php:224
msgid "Close dialog"
msgstr ""

#: legacy/public/class-wpvr-public.php:225
msgid "Tour dialog"
msgstr ""

#: legacy/public/classes/class-wpvr-shortcode.php:99
msgid "Invalid Wpvr slug attribute"
msgstr ""

#: legacy/public/classes/class-wpvr-shortcode.php:112
msgid ""
"Oops! It seems that the entered tour doesn't exist. Please enter correct "
"shortcode.<br>"
msgstr ""

#: legacy/public/classes/class-wpvr-shortcode.php:118 legacy/wpvr.php:800
msgid ""
"Oops! It seems like this post isn't published yet. Stay tuned for updates!"
msgstr ""
"Ups! Wygląda na to, że ten post nie został jeszcze opublikowany. Bądź na "
"bieżąco z aktualizacjami!"

#: legacy/public/classes/class-wpvr-shortcode.php:131 legacy/wpvr.php:721
msgid "You need to log in to access this content."
msgstr ""

#: legacy/public/classes/class-wpvr-shortcode.php:179 legacy/wpvr.php:762
msgid "You do not have access to this content."
msgstr ""

#: legacy/wpvr.php:156
msgid "You are previewing Pro features in action."
msgstr ""

#: legacy/wpvr.php:160
msgid "Normally $99.99/year"
msgstr ""

#: legacy/wpvr.php:161
msgid "SAVE 20%"
msgstr ""

#: legacy/wpvr.php:163
msgid "Starting at $79.99/year"
msgstr ""

#: legacy/wpvr.php:167
#, fuzzy
msgid "Upgrade to save changes"
msgstr "Uaktualnij do Pro"

#: legacy/wpvr.php:379
msgid "By"
msgstr ""

#: legacy/wpvr.php:811
msgid ""
"Oops! It seems that you have not selected any tour yet. Please select a tour "
"from the dropdown of WPVR block.<br>"
msgstr ""

#: legacy/wpvr.php:4208
msgid ""
"Since you have updated the plugin, please clear the browser cache for smooth "
"functioning. Follow these steps if you are using <a href=\"https://support."
"google.com/accounts/answer/32050?co=GENIE.Platform%3DDesktop&hl=en\" target="
"\"_blank\">Google Chrome</a>, <a href=\"https://support.mozilla.org/en-US/kb/"
"how-clear-firefox-cache\" target=\"_blank\">Mozilla Firefox</a>, <a href="
"\"https://clear-my-cache.com/en/apple-mac-os/safari.html\" target=\"_blank"
"\">Safai</a> or <a href=\"https://support.microsoft.com/en-us/help/10607/"
"microsoft-edge-view-delete-browser-history\" target=\"_blank\">Microsoft "
"Edge</a>"
msgstr ""
"Ponieważ zaktualizowałeś wtyczkę, wyczyść pamięć podręczną przeglądarki, aby "
"zapewnić płynne działanie. Wykonaj następujące kroki, jeśli używasz <a href="
"\"https://support.google.com/accounts/answer/32050?co=genie.platform"
"%3ddesktop&hl=pl\" target=\"_blank\">google chrome>, <a href=\"https://"
"supportull.molla.org/pl/s/how-clear-acre-cache chrome>, <a href=\"https://"
"www."
"actactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactacktactactactactactactacregweltackactactactactactactactactactactactacregcik-"
"acur-acreg-acrefur-acrefur-"
"supckactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactawna "
"lizak celour-"
"actactactactactactactactactactactactactactactactactactactactactactactac"

#: src/Admin/Admin.php:120
msgid "Edit"
msgstr ""

#: src/Admin/Admin.php:318 src/Admin/UiModeSwitcher.php:33
msgid "Switch to Classic UI"
msgstr ""

#: src/Admin/Admin.php:322 src/Admin/UiModeSwitcher.php:37
msgid "You are using the latest WP VR editor."
msgstr ""

#: src/Admin/Admin.php:333 src/Admin/UiModeSwitcher.php:159
msgid "You are not allowed to switch UI modes."
msgstr ""

#: src/Admin/Admin.php:487
#, fuzzy
msgid "Create New Tour"
msgstr "Dodaj nową wycieczkę"

#: src/Admin/Admin.php:488
msgid "Choose your tour type and get started"
msgstr ""

#: src/Admin/Admin.php:504
msgid "Enter tour name..."
msgstr ""

#: src/Admin/Admin.php:508
msgid "Tour name is required."
msgstr ""

#: src/Admin/Admin.php:526
msgid "360° Image"
msgstr ""

#: src/Admin/Admin.php:527
msgid "Create immersive panoramic image tours"
msgstr ""

#: src/Admin/Admin.php:538
#, fuzzy
msgid "360° Video"
msgstr "Wideo 360 stopni"

#: src/Admin/Admin.php:539
msgid "Build dynamic video-based experiences"
msgstr ""

#: src/Admin/Admin.php:547
msgid "Requires WP VR Pro"
msgstr ""

#: src/Admin/Admin.php:557
#, fuzzy
msgid "Integrate Google Street View locations"
msgstr "Widok ulicy Google"

#: src/Admin/Admin.php:571
msgid "+ Create Tour"
msgstr ""

#: src/Admin/UiModeSwitcher.php:34
msgid "Switch to New UI"
msgstr ""

#: src/Admin/UiModeSwitcher.php:38
msgid "You are using the classic WP VR editor."
msgstr ""

#: src/Api/Controllers/TourController.php:87
#: src/Api/Controllers/TourController.php:103
#: src/Api/Controllers/TourController.php:136
msgid "Tour not found."
msgstr ""

#: src/Api/Controllers/TourController.php:110
msgid "Save failed."
msgstr ""

#: src/Api/Controllers/TourController.php:124
msgid "Tour title or status could not be saved."
msgstr ""

#: src/Api/Controllers/TourController.php:140
msgid "Tour could not be deleted."
msgstr ""

#: wpvr.php:415
msgid "Please Activate your license key to enjoy the pro features for WPVR"
msgstr ""

#: wpvr.php:417
#, fuzzy
msgid "Activate"
msgstr "Aktywuj licencję"

#: wpvr.php:423
msgid "Your WPVR Pro license has expired."
msgstr ""

#: wpvr.php:424
msgid "Your WPVR Pro license is not active."
msgstr ""

#: wpvr.php:425
msgid ""
"Pro features are no longer available. Upgrade to Pro now to restore access "
"to all premium features."
msgstr ""

#: wpvr.php:449
msgid "Dismiss this notice."
msgstr ""

#: app/components/modals/CreateSceneModal.jsx:41
msgid "Selected image"
msgstr ""

#: app/components/modals/CreateSceneModal.jsx:128
msgid "You cannot add any more scenes in this operation."
msgstr ""

#. translators: %d: number of images that can still be selected.
#: app/components/modals/CreateSceneModal.jsx:134
msgid "You can add only %d more image(s) in this operation."
msgstr ""

#. translators: %s: comma-separated invalid image file names.
#: app/components/modals/CreateSceneModal.jsx:152
msgid "Unsupported image file(s): %s. Please use JPEG, PNG, TIFF, or WebP."
msgstr ""

#. translators: %d: position of the new scene in the current operation.
#: app/components/modals/CreateSceneModal.jsx:173
msgid "Untitle Scene - %d"
msgstr ""

#: app/components/modals/CreateSceneModal.jsx:234
#, fuzzy
msgid "Select Panorama Images"
msgstr "Prześlij obraz panoramy"

#: app/components/modals/CreateSceneModal.jsx:235
msgid "Use these images"
msgstr ""

#: app/components/modals/CreateSceneModal.jsx:339
msgid "Enter a name for every scene before creating."
msgstr ""

#. translators: %s: comma-separated file names that failed to upload.
#: app/components/modals/CreateSceneModal.jsx:398
msgid "Could not upload: %s. Please try creating the scenes again."
msgstr ""

#: app/components/modals/CreateSceneModal.jsx:418
msgid "Unable to create the selected scenes. Please try again."
msgstr ""

#: app/components/modals/CreateSceneModal.jsx:449
msgid "+ Create"
msgstr ""

#: app/components/modals/CreateSceneModal.jsx:451
#, fuzzy
msgid "+ Create Scene"
msgstr "Identyfikator sceny docelowe"

#. translators: %d: number of scenes that will be created.
#: app/components/modals/CreateSceneModal.jsx:455
msgid "+ Create %d Scenes"
msgstr ""

#: app/components/modals/CreateSceneModal.jsx:465
msgid "Create scenes"
msgstr ""

#: app/components/modals/CreateSceneModal.jsx:470
msgid "Upload Scene"
msgstr ""

#: app/components/modals/CreateSceneModal.jsx:494
msgid "Drag and drop your 360° panorama images here"
msgstr ""

#: app/components/modals/CreateSceneModal.jsx:501
msgid "Supports JPEG, PNG, TIFF, WebP"
msgstr ""

#: app/components/modals/CreateSceneModal.jsx:514
msgid "Browse Files"
msgstr ""

#. translators: 1: number of uploaded images, 2: total image uploads.
#: app/components/modals/CreateSceneModal.jsx:529
msgid "Uploading %1$d of %2$d images…"
msgstr ""

#. translators: 1: number of selected scenes, 2: maximum scenes allowed in this operation.
#: app/components/modals/CreateSceneModal.jsx:543
msgid "%1$d of %2$d scenes selected."
msgstr ""

#. translators: %d: number of scenes that can still be added in this operation.
#: app/components/modals/CreateSceneModal.jsx:554
msgid "You can add %d more scene(s) with your current limit."
msgstr ""

#. translators: %s: image file name.
#: app/components/modals/CreateSceneModal.jsx:584
msgid "Remove %s"
msgstr ""

#: app/components/modals/CreateSceneModal.jsx:599
#, fuzzy
msgid "Scene name"
msgstr "Typ sceny"

#: app/components/modals/ImageResizeWarningModal.jsx:59
msgid "Could not save the setting. Please try again."
msgstr ""

#: legacy/src/index.js:42
msgid "Solid"
msgstr ""

#: legacy/src/index.js:43
msgid "Dotted"
msgstr ""

#: legacy/src/index.js:44
msgid "Dashed"
msgstr ""

#: legacy/src/index.js:45
msgid "Double"
msgstr ""

#: legacy/src/index.js:132
#, fuzzy
msgid "Tour Settings"
msgstr "Ustawienie"

#: legacy/src/index.js:187
msgid "Appearance"
msgstr ""

#: legacy/src/index.js:189
#, fuzzy
msgid "Tour Border Radius"
msgstr "Promień granicy (PX)"

#: legacy/src/index.js:204
msgid "Tour Border Width"
msgstr ""

#: legacy/src/index.js:212
msgid "Tour Border Style"
msgstr ""

#: legacy/src/index.js:219
msgid "Tour Border Color"
msgstr ""

#: legacy/src/index.js:235
#, fuzzy
msgid "WPVR Tour Preview"
msgstr "Podgląd wycieczki"

#: legacy/src/index.js:238
msgid "Width"
msgstr "szerokość"

#: legacy/src/index.js:239
msgid "Height"
msgstr "zenit"

#: legacy/src/index.js:241
msgid "Radius"
msgstr "promień"

#: legacy/src/index.js:247
msgid "Please select a tour from the block settings panel."
msgstr ""

#: legacy/src/index.js:258
#, fuzzy
msgid "WPVR Tour"
msgstr "Identyfikator trasy WPVR"

#: legacy/src/index.js:259
msgid "Add a virtual reality tour to your content."
msgstr ""

#: legacy/src/index.js:262
msgid "vr"
msgstr ""

#: legacy/src/index.js:262
msgid "tour"
msgstr ""

#: legacy/src/index.js:262
#, fuzzy
msgid "panorama"
msgstr "Mobilna panorama"

#: legacy/src/index.js:262
msgid "virtual reality"
msgstr ""

#~ msgid " : "
#~ msgstr ": :"

#~ msgid "360 Degree Panorama"
#~ msgstr "Panorama 360 stopni"

#~ msgid ": "
#~ msgstr ": :"

#~ msgid "add"
#~ msgstr "dopłacać"

#~ msgid ""
#~ "Add a Hotspot inside your tour to show additional information like "
#~ "Paragraph, Heading, Image, Video, or multiple content."
#~ msgstr ""
#~ "Dodaj hotspot do wycieczki, aby wyświetlić dodatkowe informacje, takie "
#~ "jak akapit, nagłówek, obraz, wideo lub wiele treści."

#~ msgid "Add Scene ID "
#~ msgstr "Dodaj identyfikator sceny"

#~ msgid "Add-ons"
#~ msgstr "dodatki"

#~ msgid "Assign Pitch & Yaw"
#~ msgstr "Przypisz skok i odchyl"

#~ msgid "Back to WPVR Dashboard"
#~ msgstr "Powrót do WPVR Pulpit nawigacyjny"

#~ msgid "Background Audio"
#~ msgstr "Dźwięk w tle"

#~ msgid ""
#~ "Before You start, you can check our Documentation to get familiar with WP "
#~ "VR - 360 Panorama and virtual tour creator for WordPress."
#~ msgstr ""
#~ "Zanim zaczniesz, możesz sprawdzić naszą dokumentację, aby zapoznać się z "
#~ "WP VR - 360 Panorama i Virtual Tour Creator dla WordPress."

#~ msgid "Best WordPress Plugin"
#~ msgstr "Najlepsza wtyczka WordPress"

#~ msgid "Call to action button text"
#~ msgstr "Tekst przycisku wezwania do działania"

#~ msgid ""
#~ "Can't find solution on with our documentation? Just Post a ticket on "
#~ "Support forum. We are to solve your issue."
#~ msgstr ""
#~ "Nie możesz znaleźć rozwiązania z naszą dokumentacją? Po prostu opublikuj "
#~ "bilet na forum pomocy technicznej. Mamy rozwiązać Twój problem."

#~ msgid "Cart Lift"
#~ msgstr "Wózek podnośnikowy"

#~ msgid "Check out our other amazing free plugins!"
#~ msgstr "Sprawdź nasze inne niesamowite darmowe wtyczki!"

#~ msgid "Checkout All Features"
#~ msgstr "Sprawdź wszystkie funkcje"

#~ msgid "Choose The Spot"
#~ msgstr "Wybierz miejsce"

#~ msgid ""
#~ "Click on Preview to see how the content is appearing for the hotspot."
#~ msgstr ""
#~ "Kliknij podgląd, aby zobaczyć, jak treść wyświetla się dla hotspotu."

#~ msgid ""
#~ "Click on the Preview button to view your uploaded panorama in virtual "
#~ "tour mode."
#~ msgstr ""
#~ "Kliknij przycisk Podgląd, aby wyświetlić przesłaną panoramę w trybie "
#~ "wirtualnej wycieczki."

#~ msgid ""
#~ "Click on the Update button to save your work. And just like that, you can "
#~ "create an unlimited number of virtual tours and add your customization to "
#~ "them."
#~ msgstr ""
#~ "Kliknij przycisk Aktualizuj, aby zapisać swoją pracę. I tak po prostu "
#~ "możesz tworzyć nieograniczoną liczbę wirtualnych wycieczek i dodawać do "
#~ "nich swoją personalizację."

#~ msgid "Click on the Upload button to upload your panorama image."
#~ msgstr "Kliknij przycisk Prześlij, aby przesłać obraz panoramy."

#~ msgid ""
#~ "Click on this Publish button to save this as a tour. You can always find "
#~ "it in your tour list."
#~ msgstr ""
#~ "Kliknij ten przycisk Publikuj, aby zapisać to jako wycieczkę. Zawsze "
#~ "możesz go znaleźć na swojej liście wycieczek."

#~ msgid "Click to Upload an Image "
#~ msgstr "Kliknij, aby przesłać obraz"

#~ msgid "Contact Our Support"
#~ msgstr "Skontaktuj się z naszym wsparciem"

#~ msgid "Continue to guide"
#~ msgstr "Kontynuuj do przewodnika"

#~ msgid ""
#~ "Create high-converting slaes funnels on a visual drag & drop funnel "
#~ "builder canvas and increase your online sales from today."
#~ msgstr ""
#~ "Twórz ścieżki SLAES o wysokim konwersji na wizualnym kanwie konstruktora "
#~ "lejka przeciągnij i upuść i zwiększ sprzedaż online od dzisiaj."

#~ msgid "Cubemap Images"
#~ msgstr "Obrazy z mapą"

#~| msgid "Custom control buttons"
#~ msgid "Custom Control Buttons"
#~ msgstr "Niestandardowe przyciski sterowania"

#~ msgid ""
#~ "Custom icons will only show on frontend. Hotspot custom icons only works "
#~ "with fontawesome 5. If you are using any different version of fontawesome "
#~ "under theme or any plugin, you may deactivate fontawesome from WP VR. Go "
#~ "to \"Get Started menu\" and select \"Role\" and check fontawesome disable "
#~ "switch. Now put your desired any icon class under \"Hotspot custom icon "
#~ "class\" field. It will appear on the frontend."
#~ msgstr ""
#~ "Niestandardowe ikony będą wyświetlane tylko na frontend. Niestandardowe "
#~ "ikony Hotspot działa tylko z FontaWesome 5. Jeśli używasz innej wersji "
#~ "FontaWesome pod motywem lub jakąkolwiek wtyczką, możesz dezaktywować "
#~ "FontaWesome z WP VR. Przejdź do \"Menu Rozpocznij\" i wybierz \"Role\" i "
#~ "zaznacz FontaWesome Disable Switch. Teraz umieść żądaną klasę ikon w polu "
#~ "„Hotspot Custom Icon Class”. Pojawi się na froncie."

#~ msgid "Decisions"
#~ msgstr "decyzja"

#~ msgid "Disable keyboard control to use the form."
#~ msgstr "Wyłącz kontrolę klawiatury, aby użyć formularza."

#~ msgid ""
#~ "Do not close or refresh the page during import process. It may take few "
#~ "minutes."
#~ msgstr ""
#~ "Nie zamykaj ani nie odświeżaj strony podczas procesu importowania. Może "
#~ "to zająć kilka minut."

#~ msgid ""
#~ "Editors will be able to Create, Edit, Update, and Delete all virtual "
#~ "tours."
#~ msgstr ""
#~ "Edytorzy będą mogli tworzyć, edytować, aktualizować i usuwać wszystkie "
#~ "wirtualne wycieczki."

#~ msgid "Enable the call to action, it will render under the tour."
#~ msgstr "Włącz wezwanie do działania, zostanie wyrenderowane w ramach trasy."

#~ msgid "Enable Video"
#~ msgstr "Włącz wideo"

#~ msgid "Explainer"
#~ msgstr "wyjaśniacz"

#~ msgid "Features That Can"
#~ msgstr "Funkcje, które mogą"

#~ msgid "Follow the Guided Wizard and Learn How it Works."
#~ msgstr ""
#~ "Postępuj zgodnie z przewodnikiem kreatora i dowiedz się, jak to działa."

#~ msgid "for Choosing"
#~ msgstr "za wybór"

#~ msgid "for Virtual Tours, Viewing Panoramas, and 360 Degree Content"
#~ msgstr ""
#~ "W przypadku wirtualnych wycieczek, przeglądania panoram i zawartości 360 "
#~ "stopni"

#~ msgid "Full Screen"
#~ msgstr "pełny ekran"

#~ msgid "General"
#~ msgstr "gromadny"

#~ msgid "Get Access to "
#~ msgstr "Uzyskaj dostęp do"

#~ msgid "Get It Now"
#~ msgstr "Pobierz to teraz"

#~ msgid "Get Pro Now"
#~ msgstr "Zdobądź profesjonalistę"

#~ msgid "Give a name to your virtual tour."
#~ msgstr "Nadaj nazwę swojej wirtualnej trasie."

#~ msgid "Gyroscope"
#~ msgstr "giroskop"

#~ msgid ""
#~ "Here is a preview of your panorama image in tour mode. You can control it "
#~ "and mode around to see it in 360 degree view."
#~ msgstr ""
#~ "Oto podgląd Twojego obrazu panoramy w trybie wycieczki. Możesz nim "
#~ "sterować i trybu wokół, aby zobaczyć go w widoku 360 stopni."

#~ msgid "Here you can see the Pitch & Yaw has been set for the hotspot."
#~ msgstr ""
#~ "Tutaj możesz zobaczyć, że boisko i Yaw zostało ustawione dla hotspotu."

#~ msgid ""
#~ "Here, you can set what content your viewer will see after clicking on the "
#~ "Hotspot. You can either set an URL or any other content using this "
#~ "editor. To learn more, follow this guide to set content using editor"
#~ msgstr ""
#~ "Tutaj możesz ustawić, jakie treści zobaczy Twój widz po kliknięciu w "
#~ "hotspot. Możesz ustawić adres URL lub inną zawartość za pomocą tego "
#~ "edytora. Aby dowiedzieć się więcej, postępuj zgodnie z tym przewodnikiem, "
#~ "aby ustawić zawartość za pomocą edytora"

#~ msgid "Home"
#~ msgstr "ojczyzna"

#~ msgid "Hook"
#~ msgstr "uczepić"

#~ msgid "ID"
#~ msgstr "dowód osobisty"

#~ msgid "ID:"
#~ msgstr "ID:"

#~ msgid ""
#~ "If set to true, device orientation control will be used when the panorama "
#~ "is loaded, if the device supports it. If false, device orientation "
#~ "control needs to be activated by pressing a button. Defaults to false. "
#~ "Will work if gyroscope is enabled"
#~ msgstr ""
#~ "Jeśli ustawione na true, kontrola orientacji urządzenia będzie używana, "
#~ "gdy panorama jest załadowana, jeśli urządzenie ją obsługuje. Jeśli false, "
#~ "kontrola orientacji urządzenia musi być aktywowana przez naciśnięcie "
#~ "przycisku. domyślnie na false. będzie działać, jeśli żyroskop jest "
#~ "włączony"

#~ msgid ""
#~ "In this Preview, drag to your desired location and click on it, exactly "
#~ "where you want to set the hotspot"
#~ msgstr ""
#~ "W tym podglądzie przeciągnij do żądanej lokalizacji i kliknij ją, "
#~ "dokładnie tam, gdzie chcesz ustawić hotspot"

#~ msgid "Learn more"
#~ msgstr "Więcej"

#~ msgid "Make WPVR Popular"
#~ msgstr "Spraw, aby WPVR był popularny"

#~ msgid "More Pro Features"
#~ msgstr "Więcej funkcji Pro"

#~ msgid "Move Up"
#~ msgstr "podnieść"

#~ msgid "Multiple Content on Hotspots"
#~ msgstr "Wiele treści w hotspotach"

#~ msgid ""
#~ "Once you see the Pitch & Yaw value for the spot, click on this Arrow. "
#~ "It'll be set as the coordinate for your hotspot"
#~ msgstr ""
#~ "Gdy zobaczysz wartość Pitch & Yaw dla miejsca, kliknij tę strzałkę. "
#~ "zostanie ustawiony jako współrzędna dla twojego hotspotu"

#~ msgid "Personalize your virtual tours, in the way you want."
#~ msgstr "Spersonalizuj swoje wirtualne wycieczki w sposób, w jaki chcesz."

#~ msgid "Pitch & Yaw is Set"
#~ msgstr "Pitch & Yaw jest ustawiony"

#~ msgid "Post a Ticket"
#~ msgstr "Opublikuj bilet"

#~ msgid "Preview The Image in Tour Mode"
#~ msgstr "Podgląd obrazu w trybie wycieczki"

#~ msgid "Preview Your Hotspot Content"
#~ msgstr "Wyświetl podgląd zawartości Hotspot"

#~| msgid "Rate Us! "
#~ msgid "Rate Us "
#~ msgstr "Oceń nas"

#~ msgid "Read Documentations"
#~ msgstr "Przeczytaj dokumentację"

#~ msgid "Read Our Complete Guides"
#~ msgstr "Przeczytaj nasze kompletne przewodniki"

#~ msgid ""
#~ "Recover abandoned carts with automated email drip campaigns. Start "
#~ "getting back lost sales on your online store."
#~ msgstr ""
#~ "Odzyskiwanie porzuconych koszyków dzięki zautomatyzowanym kampaniom "
#~ "kroplowym. Zacznij odzyskiwać utraconą sprzedaż w swoim sklepie "
#~ "internetowym."

#~ msgid "Save"
#~ msgstr "uratować"

#~ msgid "Save Your Progress"
#~ msgstr "Zapisz swoje postępy"

#~ msgid "Sell WooCommerce Products"
#~ msgstr "Sprzedawaj produkty WooCommerce"

#~ msgid ""
#~ "Set a time after which auto rotation will stop. Assign in milliseconds, "
#~ "where 1000 milliseconds = 1 second."
#~ msgstr ""
#~ "Ustaw czas, po którym zatrzyma się automatyczna obrót. Przypisz w "
#~ "milisekundach, gdzie 1000 milisekund = 1 sekunda."

#~ msgid "Set a Title to Your Virtual Tour"
#~ msgstr "Ustaw tytuł na swoją wirtualną wycieczkę"

#~ msgid ""
#~ "Set a value to determine the speed of rotation. The higher the number, "
#~ "the faster it will rotate. Positive values will make it rotate clockwise "
#~ "and negative values will make it rotate anti clockwise"
#~ msgstr ""
#~ "Ustaw wartość, aby określić prędkość obrotu. Im wyższa liczba, tym "
#~ "szybciej się obraca. Dodatnie wartości sprawią, że obróci się zgodnie z "
#~ "ruchem wskazówek zegara, a wartości ujemne sprawią, że obróci się "
#~ "przeciwnie do ruchu"

#~ msgid ""
#~ "Set an unique Hotspot ID to each of your Hotspots. Avoid Spaces & special "
#~ "characters. Set it like H1 or 01"
#~ msgstr ""
#~ "Ustaw unikalny identyfikator hotspotu dla każdego ze swoich hotspotów. "
#~ "Unikaj spacji i znaków specjalnych. Ustaw to jak h1 lub 01"

#~ msgid "Set Contact Form"
#~ msgstr "Ustaw formularz kontaktowy"

#~ msgid "Set Hotspot ID"
#~ msgstr "Ustaw identyfikator hotspotu"

#~ msgid "Set The Content for Click Action"
#~ msgstr "Ustaw treść dla akcji kliknięcia"

#~ msgid ""
#~ "Set the Scene ID for your first panorama image. The Scene ID has to be "
#~ "unique for each scene and without any spaces or special characters. You "
#~ "can set it as Scene1, S1, or simply 01."
#~ msgstr ""
#~ "Ustaw identyfikator sceny dla pierwszego obrazu panoramy. Identyfikator "
#~ "sceny musi być unikalny dla każdej sceny i bez spacji i znaków "
#~ "specjalnych. Możesz ustawić go jako Scene1, S1 lub po prostu 01."

#~ msgid "Share On"
#~ msgstr "dzielić na"

#~ msgid "Starts from only"
#~ msgstr "zaczyna się tylko od"

#~ msgid "Submit"
#~ msgstr "poddać pod"

#~ msgid "Support"
#~ msgstr "dźwigać"

#~ msgid "Take The Tour"
#~ msgstr "Weź udział w wycieczce"

#~ msgid "Thank you"
#~ msgstr "dziękuję"

#~ msgid ""
#~ "The notice will appear on the front end of the virtual tour if viewed "
#~ "from a mobile device."
#~ msgstr ""
#~ "Powiadomienie pojawi się na przedniej części wirtualnej wycieczki, jeśli "
#~ "jest oglądane z urządzenia mobilnego."

#~ msgid ""
#~ "This option will display Zoom In, Zoom Out and Full Screen buttons on the "
#~ "tour."
#~ msgstr ""
#~ "Ta opcja wyświetli przyciski powiększenia, pomniejszenia i pełnego ekranu "
#~ "podczas trasy."

#~ msgid "Tour Preview Image will not appear if this is turned on."
#~ msgstr "Obraz podglądu trasy nie pojawi się, jeśli jest włączony."

#~ msgid ""
#~ "Turning it On will display a gallery with all the scenes on your tour. By "
#~ "double clicking on a scene thumbnail on the gallery, you can move to that "
#~ "specific scene. The gallery will only show up on the front end and not on "
#~ "the preview."
#~ msgstr ""
#~ "Włączenie go wyświetli galerię ze wszystkimi scenami podczas wycieczki. "
#~ "Dwukrotnie klikając miniaturę sceny w galerii, możesz przejść do tej "
#~ "konkretnej sceny. Galeria pojawi się tylko na przedniej stronie, a nie na "
#~ "podglądzie."

#~ msgid "Unlock all these options by upgrading to Premium version"
#~ msgstr "Odblokuj wszystkie te opcje, aktualizując wersję premium"

#~ msgid "Upgrade Now"
#~ msgstr "Uaktualnij teraz"

#~ msgid "Video Tutorials"
#~ msgstr "Samouczki wideo"

#~ msgid ""
#~ "When someone clicks on the tour, auto-rotation stops. Here, set a time "
#~ "after which auto rotation will start again. Assign in milliseconds, where "
#~ "1000 milliseconds = 1 second."
#~ msgstr ""
#~ "Gdy ktoś kliknie na trasę, automatyczne obracanie zatrzymuje się. Tutaj "
#~ "ustaw czas, po którym automatyczne obracanie rozpocznie się ponownie. "
#~ "Przypisz w milisekundach, gdzie 1000 milisekund = 1 sekunda."

#~ msgid ""
#~ "Will activate the VR Glass support on mobile devices. This is the Beta "
#~ "release. So, if you face any issues with it, please contact us at "
#~ "support@rextheme.com"
#~ msgstr ""
#~ "Aktywuje obsługę VR Glass na urządzeniach mobilnych. To jest wydanie "
#~ "beta. Jeśli więc napotkasz jakiekolwiek problemy z nim, skontaktuj się z "
#~ "nami pod adresem support@rextheme.com"

#~ msgid ""
#~ "Will convert any jpeg or png image to webp format during media upload. "
#~ "will decrease the image size with no quality compromise and help the site "
#~ "to load faster."
#~ msgstr ""
#~ "Przekonwertuje dowolny obraz JPEG lub PNG na format WebP podczas "
#~ "przesyłania multimediów. Zmniejszy rozmiar obrazu bez kompromisów jakości "
#~ "i pomoże witrynie szybciej się ładować."

#~ msgid ""
#~ "WordPress's default large image handler for images larger than 2560px "
#~ "will be disabled for WP VR. So can create virtual tours with extremely "
#~ "high-quality images. Enabling it will also show high res image on mobile "
#~ "devices. Many devices may not support that resolution."
#~ msgstr ""
#~ "Domyślna obsługa obrazów WordPress dla dużych obrazów o większych niż "
#~ "2560 pikseli zostanie wyłączona dla WP VR. Dzięki temu można tworzyć "
#~ "wirtualne wycieczki z niezwykle wysokiej jakości obrazami. Włączenie go "
#~ "również wyświetli obraz w wysokiej rozdzielczości na urządzeniach "
#~ "mobilnych. Wiele urządzeń może nie obsługiwać tej rozdzielczości."

#~ msgid ""
#~ "WP VR assets will be loaded on your allowed pages only. If you turn this "
#~ "on, you have to list the URL's of the pages with virtual tours on the "
#~ "'List of allowed pages to load WP VR scripts' option"
#~ msgstr ""
#~ "Zasoby WP VR będą ładowane tylko na dozwolonych stronach. Jeśli to "
#~ "włączysz, musisz wyświetlić adresy URL stron z wirtualnymi wycieczkami na "
#~ "opcji „Lista dozwolonych stron do załadowania skryptów WP VR”"

#~ msgid "WP VR will not load Font Awesome library."
#~ msgstr "WP VR nie załaduje czcionki niesamowitej biblioteki."

#~ msgid "WP VR will resize each scenes for mobile devices."
#~ msgstr "WP VR zmieni rozmiar każdej sceny na urządzenia mobilne."

#~ msgid "WPFunnels"
#~ msgstr "WPFunnele"

#~ msgid "WPVR Feature Comparison"
#~ msgstr "Porównanie funkcji WPVR"

#~ msgid "Write your custom css"
#~ msgstr "Napisz swój niestandardowy CSS"

#~ msgid ""
#~ "You can disable on hover content for mobile devices. As most of the "
#~ "devices are touch based."
#~ msgstr ""
#~ "Możesz wyłączyć zawartość najechania na urządzeniach mobilnych. Ponieważ "
#~ "większość urządzeń jest opartych na dotyku."

#~ msgid ""
#~ "You can use any image size but maximum image upload size recommended to "
#~ "support all device is 4096x2000 px for perfect responsive view. To check "
#~ "360 view, click on preview button and check tour preview metabox."
#~ msgstr ""
#~ "Możesz użyć dowolnego rozmiaru obrazu, ale maksymalny rozmiar przesyłania "
#~ "obrazu zalecany do obsługi wszystkich urządzeń to 4096x2000 pikseli, aby "
#~ "uzyskać doskonały responsywny widok. Aby sprawdzić widok 360, kliknij "
#~ "przycisk Podgląd i sprawdź Metabox podglądu wycieczki."

#~ msgid "Your Image In Tour Mode"
#~ msgstr "Twój obraz w trybie wycieczki"

#~ msgid ""
#~ "Your rating and feedback matters to us. If you are happy with WP VR - 360 "
#~ "Panorama and virtual tour creator for WordPress give us a rating."
#~ msgstr ""
#~ "Twoja ocena i opinie są dla nas ważne. Jeśli jesteś zadowolony z WP VR - "
#~ "360 Panorama i Virtual Tour Creator dla WordPress, daj nam ocenę."

#~ msgid "Your Viewers - And Make Them Take"
#~ msgstr "Twoi widzowie - i spraw, aby zabrali"

#~ msgid ""
#~ "Zoom interval is 50 to 120 degree. You can put any value between 50 to "
#~ "120. As an example, if you set 100, the scene will display with zoom in "
#~ "100 degree on each load."
#~ msgstr ""
#~ "Odstęp powiększenia wynosi od 50 do 120 stopni. Możesz umieścić dowolną "
#~ "wartość od 50 do 120. Na przykład, jeśli ustawisz 100, scena będzie "
#~ "wyświetlana z powiększeniem w 100 stopni przy każdym obciążeniu."

```
