PluginProbe
WPVR – 360 Panorama viewer and Virtual Tour Builder for WordPress / 8.5.78
WPVR – 360 Panorama viewer and Virtual Tour Builder for WordPress v8.5.78
9.1.3 9.1.2 9.1.1 9.1.0 9.0.3 9.0.2 9.0.1 9.0.0 8.5.79 8.5.78 8.5.77 8.5.76 8.5.75 8.5.74 8.5.73 8.5.72 8.5.71 8.5.70 8.5.69 8.5.68 8.5.35 8.5.36 8.5.37 8.5.38 8.5.39 All 222 releases
wpvr / languages / wpvr-pl_PL.po

wpvr-pl_PL.po in WPVR – 360 Panorama viewer and Virtual Tour Builder for WordPress 8.5.78, at languages/wpvr-pl_PL.po

2,485 lines 88.6 KB
No matching file
Up and down to move Enter to open Esc to close
Raw Download Zip
1 msgid ""
2 msgstr ""
3 "Project-Id-Version: WP VR\n"
4 "Report-Msgid-Bugs-To: \n"
5 "POT-Creation-Date: 2019-12-11 10:17+0000\n"
6 "PO-Revision-Date: 2025-08-20 07:18+0000\n"
7 "Last-Translator: \n"
8 "Language-Team: Polish\n"
9 "Language: pl_PL\n"
10 "Plural-Forms: nplurals=3; plural=(n==1 ? 0 : n%10 >= 2 && n%10<=4 "
11 "&&(n%100<10||n%100 >= 20)? 1 : 2);\n"
12 "MIME-Version: 1.0\n"
13 "Content-Type: text/plain; charset=UTF-8\n"
14 "Content-Transfer-Encoding: 8bit\n"
15 "X-Generator: Loco https://localise.biz/\n"
16 "X-Loco-Version: 2.8.0; wp-6.8.2; php-8.3.8"
17
18 #: admin/classes/class-wpvr-meta-field.php:2256
19 #: production/admin/classes/class-wpvr-meta-field.php:2256
20 msgid " : "
21 msgstr ": :"
22
23 #: oxygen/elements/Wpvr_Tour_Element.php:77
24 #: production/oxygen/elements/Wpvr_Tour_Element.php:77
25 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:119
26 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:119
27 msgid "%"
28 msgstr "prokuratura"
29
30 #: admin/partials/wpvr_setup_wizard.php:51
31 #: production/admin/partials/wpvr_setup_wizard.php:51
32 msgid "360 Degree Panorama"
33 msgstr "Panorama 360 stopni"
34
35 #: admin/partials/wpvr_setup_wizard.php:87
36 #: production/admin/partials/wpvr_setup_wizard.php:87
37 msgid "360 Degree Video"
38 msgstr "Wideo 360 stopni"
39
40 #: admin/partials/wpvr_documentation.php:488
41 #: production/admin/partials/wpvr_documentation.php:488
42 msgid "360 Video Support"
43 msgstr "Wsparcie wideo 360"
44
45 #: admin/partials/wpvr_documentation.php:460
46 #: production/admin/partials/wpvr_documentation.php:460
47 msgid "900+ Icons & RGB Color Support for Hotspots"
48 msgstr "900+ ikon i obsługa kolorów RGB dla hotspotów"
49
50 #: admin/classes/class-wpvr-meta-field.php:1648
51 #: admin/classes/class-wpvr-meta-field.php:1674
52 #: admin/classes/class-wpvr-meta-field.php:1699
53 #: admin/classes/class-wpvr-meta-field.php:1721
54 #: admin/classes/class-wpvr-meta-field.php:1844
55 #: admin/classes/class-wpvr-meta-field.php:1876
56 #: admin/classes/class-wpvr-meta-field.php:1909
57 #: admin/classes/class-wpvr-meta-field.php:1937
58 #: admin/classes/class-wpvr-meta-field.php:1970
59 #: admin/classes/class-wpvr-meta-field.php:1995
60 #: admin/classes/class-wpvr-meta-field.php:2020
61 #: admin/classes/class-wpvr-meta-field.php:2081
62 #: admin/classes/class-wpvr-meta-field.php:2107
63 #: admin/classes/class-wpvr-meta-field.php:2148
64 #: admin/classes/class-wpvr-meta-field.php:2177
65 #: admin/classes/class-wpvr-meta-field.php:2209
66 #: admin/classes/class-wpvr-meta-field.php:2291
67 #: admin/classes/class-wpvr-meta-field.php:2313
68 #: admin/classes/class-wpvr-meta-field.php:2337
69 #: admin/classes/class-wpvr-meta-field.php:2370
70 #: admin/classes/class-wpvr-meta-field.php:2390
71 #: admin/classes/class-wpvr-meta-field.php:2420
72 #: admin/classes/class-wpvr-meta-field.php:2445
73 #: admin/classes/class-wpvr-meta-field.php:2472
74 #: admin/classes/class-wpvr-meta-field.php:2496
75 #: admin/classes/class-wpvr-meta-field.php:2523
76 #: admin/classes/class-wpvr-meta-field.php:2556
77 #: admin/classes/class-wpvr-meta-field.php:2586
78 #: admin/classes/class-wpvr-meta-field.php:2610
79 #: admin/classes/class-wpvr-meta-field.php:2634
80 #: admin/classes/class-wpvr-meta-field.php:2658
81 #: admin/classes/class-wpvr-meta-field.php:2681
82 #: admin/classes/class-wpvr-meta-field.php:2706
83 #: admin/classes/class-wpvr-meta-field.php:2732
84 #: admin/classes/class-wpvr-meta-field.php:2756
85 #: admin/classes/class-wpvr-meta-field.php:2795
86 #: admin/classes/class-wpvr-meta-field.php:2820
87 #: admin/classes/class-wpvr-meta-field.php:2848
88 #: admin/classes/class-wpvr-meta-field.php:2890
89 #: admin/classes/class-wpvr-meta-field.php:2922
90 #: admin/classes/class-wpvr-meta-field.php:2973
91 #: production/admin/classes/class-wpvr-meta-field.php:1648
92 #: production/admin/classes/class-wpvr-meta-field.php:1674
93 #: production/admin/classes/class-wpvr-meta-field.php:1699
94 #: production/admin/classes/class-wpvr-meta-field.php:1721
95 #: production/admin/classes/class-wpvr-meta-field.php:1844
96 #: production/admin/classes/class-wpvr-meta-field.php:1876
97 #: production/admin/classes/class-wpvr-meta-field.php:1909
98 #: production/admin/classes/class-wpvr-meta-field.php:1937
99 #: production/admin/classes/class-wpvr-meta-field.php:1970
100 #: production/admin/classes/class-wpvr-meta-field.php:1995
101 #: production/admin/classes/class-wpvr-meta-field.php:2020
102 #: production/admin/classes/class-wpvr-meta-field.php:2081
103 #: production/admin/classes/class-wpvr-meta-field.php:2107
104 #: production/admin/classes/class-wpvr-meta-field.php:2148
105 #: production/admin/classes/class-wpvr-meta-field.php:2177
106 #: production/admin/classes/class-wpvr-meta-field.php:2209
107 #: production/admin/classes/class-wpvr-meta-field.php:2291
108 #: production/admin/classes/class-wpvr-meta-field.php:2313
109 #: production/admin/classes/class-wpvr-meta-field.php:2337
110 #: production/admin/classes/class-wpvr-meta-field.php:2370
111 #: production/admin/classes/class-wpvr-meta-field.php:2390
112 #: production/admin/classes/class-wpvr-meta-field.php:2420
113 #: production/admin/classes/class-wpvr-meta-field.php:2445
114 #: production/admin/classes/class-wpvr-meta-field.php:2472
115 #: production/admin/classes/class-wpvr-meta-field.php:2496
116 #: production/admin/classes/class-wpvr-meta-field.php:2523
117 #: production/admin/classes/class-wpvr-meta-field.php:2556
118 #: production/admin/classes/class-wpvr-meta-field.php:2586
119 #: production/admin/classes/class-wpvr-meta-field.php:2610
120 #: production/admin/classes/class-wpvr-meta-field.php:2634
121 #: production/admin/classes/class-wpvr-meta-field.php:2658
122 #: production/admin/classes/class-wpvr-meta-field.php:2681
123 #: production/admin/classes/class-wpvr-meta-field.php:2706
124 #: production/admin/classes/class-wpvr-meta-field.php:2732
125 #: production/admin/classes/class-wpvr-meta-field.php:2756
126 #: production/admin/classes/class-wpvr-meta-field.php:2795
127 #: production/admin/classes/class-wpvr-meta-field.php:2820
128 #: production/admin/classes/class-wpvr-meta-field.php:2848
129 #: production/admin/classes/class-wpvr-meta-field.php:2890
130 #: production/admin/classes/class-wpvr-meta-field.php:2922
131 #: production/admin/classes/class-wpvr-meta-field.php:2973
132 msgid ": "
133 msgstr ": :"
134
135 #: admin/partials/wpvr_license.php:28 admin/partials/wpvr_license.php:38
136 #: production/admin/partials/wpvr_license.php:28
137 #: production/admin/partials/wpvr_license.php:38
138 msgid "Activate License"
139 msgstr "Aktywuj licencję"
140
141 #: admin/partials/wpvr_documentation.php:781
142 #: production/admin/partials/wpvr_documentation.php:781
143 msgid "add"
144 msgstr "dopłacać"
145
146 #: admin/classes/class-tour-guide-translation.php:44
147 #: production/admin/classes/class-tour-guide-translation.php:44
148 msgid ""
149 "Add a Hotspot inside your tour to show additional information like Paragraph,"
150 " Heading, Image, Video, or multiple content."
151 msgstr ""
152 "Dodaj hotspot do wycieczki, aby wyświetlić dodatkowe informacje, takie jak "
153 "akapit, nagłówek, obraz, wideo lub wiele treści."
154
155 #: admin/classes/class-wpvr-meta-field.php:757
156 #: production/admin/classes/class-wpvr-meta-field.php:757
157 msgid "Add Company Information"
158 msgstr "Dodaj informacje o firmie"
159
160 #: admin/classes/class-wpvr-meta-field.php:427
161 #: production/admin/classes/class-wpvr-meta-field.php:427
162 msgid "Add Form Shortcode"
163 msgstr "Dodaj krótki kod formularza"
164
165 #: admin/classes/class-wpvr-admin-pages.php:73
166 #: production/admin/classes/class-wpvr-admin-pages.php:73
167 msgid "Add New Tour"
168 msgstr "Dodaj now�
169 wycieczkę"
170
171 #: admin/classes/class-tour-guide-translation.php:17
172 #: production/admin/classes/class-tour-guide-translation.php:17
173 msgid "Add Scene ID "
174 msgstr "Dodaj identyfikator sceny"
175
176 #: admin/partials/wpvr_setup_wizard.php:193
177 #: production/admin/partials/wpvr_setup_wizard.php:193
178 msgid "Add-ons"
179 msgstr "dodatki"
180
181 #: admin/class-wpvr-admin.php:216
182 msgid "Adding Hotspots on Scene"
183 msgstr "Dodawanie hotspotów na scenie"
184
185 #: admin/classes/class-wpvr-meta-field.php:1318
186 #: production/admin/classes/class-wpvr-meta-field.php:1318
187 msgid "Advanced Controls"
188 msgstr "Zaawansowane sterowanie"
189
190 #: admin/partials/wpvr_documentation.php:847
191 #: production/admin/partials/wpvr_documentation.php:847
192 msgid ""
193 "Allow the Authors of your site to Create, Edit, Update, and Delete virtual "
194 "tours (They can access their own tours only):"
195 msgstr ""
196 "Zezwól autorom Twojej witryny na tworzenie, edycję, aktualizację i usuwanie "
197 "wirtualnych wycieczek (mog�
198 uzyskać dostęp tylko do własnych wycieczek):"
199
200 #: admin/partials/wpvr_documentation.php:822
201 #: production/admin/partials/wpvr_documentation.php:822
202 msgid ""
203 "Allow the Editors of your site to Create, Edit, Update, and Delete virtual "
204 "tours (They can access other users' tours):"
205 msgstr ""
206 "Zezwól redaktorom Twojej witryny na tworzenie, edycję, aktualizację i "
207 "usuwanie wirtualnych wycieczek (mog�
208 uzyskać dostęp do wycieczek innych "
209 "użytkowników):"
210
211 #: admin/classes/class-tour-guide-translation.php:55
212 #: production/admin/classes/class-tour-guide-translation.php:55
213 msgid "Assign Pitch & Yaw"
214 msgstr "Przypisz skok i odchyl"
215
216 #: admin/partials/wpvr_documentation.php:868
217 #: production/admin/partials/wpvr_documentation.php:868
218 msgid ""
219 "Authors will be able to Create, Edit, Update, and Delete their own virtual "
220 "tours only."
221 msgstr ""
222 "Autorzy będ�
223 mogli tworzyć, edytować, aktualizować i usuwać tylko własne "
224 "wirtualne wycieczki."
225
226 #: admin/classes/class-wpvr-meta-field.php:680
227 #: production/admin/classes/class-wpvr-meta-field.php:680
228 msgid "Auto Gyroscope Support"
229 msgstr "Obsługa żyroskopu samochodowego"
230
231 #: admin/classes/class-wpvr-meta-field.php:218
232 #: production/admin/classes/class-wpvr-meta-field.php:218
233 msgid "Auto Rotation"
234 msgstr "Obrót automatyczny"
235
236 #: admin/partials/wpvr_documentation.php:758
237 #: production/admin/partials/wpvr_documentation.php:758
238 msgid "Autoload & Autoplay Video Tours."
239 msgstr "Automatyczne ładowanie i autoodtwarzanie wideo."
240
241 #: admin/partials/wpvr_documentation.php:556
242 #: production/admin/partials/wpvr_documentation.php:556
243 msgid "Autoload Tours"
244 msgstr "Wycieczki z automatycznym ładowaniem"
245
246 #: admin/partials/wpvr_setup_wizard.php:8
247 #: production/admin/partials/wpvr_setup_wizard.php:8
248 msgid "Back to WPVR Dashboard"
249 msgstr "Powrót do WPVR Pulpit nawigacyjny"
250
251 #: admin/partials/wpvr_setup_wizard.php:169
252 #: production/admin/partials/wpvr_setup_wizard.php:169
253 msgid "Background Audio"
254 msgstr "Dźwięk w tle"
255
256 #: admin/classes/class-wpvr-meta-field.php:3032
257 #: production/admin/classes/class-wpvr-meta-field.php:3032
258 msgid "Background Color"
259 msgstr "Kolor tła"
260
261 #: admin/partials/wpvr_documentation.php:693
262 #: production/admin/partials/wpvr_documentation.php:693
263 msgid "Background Panoramas"
264 msgstr "Panoramy w tle"
265
266 #: admin/classes/class-wpvr-meta-field.php:160
267 #: production/admin/classes/class-wpvr-meta-field.php:160
268 msgid "Basic Control Buttons"
269 msgstr "Podstawowe przyciski sterowania"
270
271 #: admin/classes/class-wpvr-meta-field.php:1309
272 #: production/admin/classes/class-wpvr-meta-field.php:1309
273 msgid "Basic Settings"
274 msgstr "Podstawowe ustawienia"
275
276 #: admin/partials/wpvr_documentation.php:206
277 #: production/admin/partials/wpvr_documentation.php:206
278 msgid ""
279 "Before You start, you can check our Documentation to get familiar with WP VR "
280 "- 360 Panorama and virtual tour creator for WordPress."
281 msgstr ""
282 "Zanim zaczniesz, możesz sprawdzić nasz�
283 dokumentację, aby zapoznać się z WP "
284 "VR - 360 Panorama i Virtual Tour Creator dla WordPress."
285
286 #: admin/partials/wpvr_setup_wizard.php:43
287 #: production/admin/partials/wpvr_setup_wizard.php:43
288 msgid "Best WordPress Plugin"
289 msgstr "Najlepsza wtyczka WordPress"
290
291 #: admin/classes/class-wpvr-meta-field.php:3118
292 #: production/admin/classes/class-wpvr-meta-field.php:3118
293 msgid "Border"
294 msgstr "okalać"
295
296 #: admin/classes/class-wpvr-meta-field.php:3113
297 #: production/admin/classes/class-wpvr-meta-field.php:3113
298 msgid "Border Radius (px)"
299 msgstr "Promień granicy (PX)"
300
301 #: admin/classes/class-wpvr-meta-field.php:3156
302 #: production/admin/classes/class-wpvr-meta-field.php:3156
303 msgid "Bottom"
304 msgstr "spód"
305
306 #: admin/classes/class-wpvr-meta-field.php:3084
307 #: production/admin/classes/class-wpvr-meta-field.php:3084
308 msgid "Button Alignment"
309 msgstr "Wyrównanie przycisków"
310
311 #: admin/classes/class-wpvr-meta-field.php:460
312 #: production/admin/classes/class-wpvr-meta-field.php:460
313 msgid "Button Style"
314 msgstr "Styl przycisku"
315
316 #: admin/classes/class-wpvr-meta-field.php:443
317 #: production/admin/classes/class-wpvr-meta-field.php:443
318 msgid "Button Text"
319 msgstr "Tekst przycisku"
320
321 #: admin/classes/class-wpvr-meta-field.php:451
322 #: production/admin/classes/class-wpvr-meta-field.php:451
323 msgid "Button URL"
324 msgstr "Adres URL przycisku"
325
326 #: admin/classes/class-wpvr-meta-field.php:276
327 #: production/admin/classes/class-wpvr-meta-field.php:276
328 msgid "Call To Action "
329 msgstr "wezwanie"
330
331 #: admin/classes/class-wpvr-meta-field.php:448
332 #: production/admin/classes/class-wpvr-meta-field.php:448
333 msgid "Call to action button text"
334 msgstr "Tekst przycisku wezwania do działania"
335
336 #: admin/partials/wpvr_documentation.php:218
337 #: production/admin/partials/wpvr_documentation.php:218
338 msgid ""
339 "Can't find solution on with our documentation? Just Post a ticket on Support "
340 "forum. We are to solve your issue."
341 msgstr ""
342 "Nie możesz znaleźć rozwi�
343 zania z nasz�
344 dokumentacj�
345 ? Po prostu opublikuj "
346 "bilet na forum pomocy technicznej. Mamy rozwi�
347 zać Twój problem."
348
349 #: admin/classes/class-wpvr-meta-field.php:3079
350 #: production/admin/classes/class-wpvr-meta-field.php:3079
351 msgid "Capitalize"
352 msgstr "spieniężać"
353
354 #: admin/partials/wpvr_documentation.php:256
355 #: production/admin/partials/wpvr_documentation.php:256
356 msgid "Cart Lift"
357 msgstr "Wózek podnośnikowy"
358
359 #: admin/classes/class-wpvr-meta-field.php:3088
360 #: production/admin/classes/class-wpvr-meta-field.php:3088
361 msgid "Center"
362 msgstr "skupisko"
363
364 #: admin/partials/wpvr_documentation.php:237
365 #: production/admin/partials/wpvr_documentation.php:237
366 msgid "Check out our other amazing free plugins!"
367 msgstr "Sprawdź nasze inne niesamowite darmowe wtyczki!"
368
369 #: admin/partials/wpvr_setup_wizard.php:189
370 #: production/admin/partials/wpvr_setup_wizard.php:189
371 msgid "Checkout All Features"
372 msgstr "Sprawdź wszystkie funkcje"
373
374 #: admin/classes/class-tour-guide-translation.php:51
375 #: production/admin/classes/class-tour-guide-translation.php:51
376 msgid "Choose The Spot"
377 msgstr "Wybierz miejsce"
378
379 #: admin/classes/class-tour-guide-translation.php:76
380 #: production/admin/classes/class-tour-guide-translation.php:76
381 msgid "Click on Preview to see how the content is appearing for the hotspot."
382 msgstr "Kliknij podgl�
383 d, aby zobaczyć, jak treść wyświetla się dla hotspotu."
384
385 #: admin/classes/class-tour-guide-translation.php:27
386 #: production/admin/classes/class-tour-guide-translation.php:27
387 msgid ""
388 "Click on the Preview button to view your uploaded panorama in virtual tour "
389 "mode."
390 msgstr ""
391 "Kliknij przycisk Podgl�
392 d, aby wyświetlić przesłan�
393 panoramę w trybie "
394 "wirtualnej wycieczki."
395
396 #: admin/classes/class-tour-guide-translation.php:80
397 #: production/admin/classes/class-tour-guide-translation.php:80
398 msgid ""
399 "Click on the Update button to save your work. And just like that, you can "
400 "create an unlimited number of virtual tours and add your customization to "
401 "them."
402 msgstr ""
403 "Kliknij przycisk Aktualizuj, aby zapisać swoj�
404 pracę. I tak po prostu możesz "
405 "tworzyć nieograniczon�
406 liczbę wirtualnych wycieczek i dodawać do nich swoj�
407 "
408 "personalizację."
409
410 #: admin/classes/class-tour-guide-translation.php:22
411 #: production/admin/classes/class-tour-guide-translation.php:22
412 msgid "Click on the Upload button to upload your panorama image."
413 msgstr "Kliknij przycisk Prześlij, aby przesłać obraz panoramy."
414
415 #: admin/classes/class-tour-guide-translation.php:35
416 #: production/admin/classes/class-tour-guide-translation.php:35
417 msgid ""
418 "Click on this Publish button to save this as a tour. You can always find it "
419 "in your tour list."
420 msgstr ""
421 "Kliknij ten przycisk Publikuj, aby zapisać to jako wycieczkę. Zawsze możesz "
422 "go znaleźć na swojej liście wycieczek."
423
424 #: admin/classes/class-wpvr-meta-field.php:2264
425 #: production/admin/classes/class-wpvr-meta-field.php:2264
426 msgid "Click to Upload an Image "
427 msgstr "Kliknij, aby przesłać obraz"
428
429 #: admin/classes/class-wpvr-meta-field.php:3137
430 #: production/admin/classes/class-wpvr-meta-field.php:3137
431 msgid "Color"
432 msgstr "zafarb"
433
434 #: admin/partials/wpvr_documentation.php:609
435 #: production/admin/partials/wpvr_documentation.php:609
436 msgid "Company Logo & Description"
437 msgstr "Logo firmy i opis"
438
439 #: admin/classes/class-wpvr-meta-field.php:688
440 #: production/admin/classes/class-wpvr-meta-field.php:688
441 msgid "Compass"
442 msgstr "opasanie"
443
444 #: admin/partials/wpvr_setup_wizard.php:217
445 #: production/admin/partials/wpvr_setup_wizard.php:217
446 msgid "Contact Our Support"
447 msgstr "Skontaktuj się z naszym wsparciem"
448
449 #: admin/classes/class-tour-guide-translation.php:24
450 #: production/admin/classes/class-tour-guide-translation.php:24
451 msgid "Continue to guide"
452 msgstr "Kontynuuj do przewodnika"
453
454 #: admin/classes/class-wpvr-meta-field.php:1327
455 #: production/admin/classes/class-wpvr-meta-field.php:1327
456 msgid "Control Buttons"
457 msgstr "Przyciski steruj�
458 ce"
459
460 #: admin/partials/wpvr_documentation.php:651
461 #: production/admin/partials/wpvr_documentation.php:651
462 msgid "Control Horizontal & Vertical View of Panorama Images"
463 msgstr "Kontroluj poziomy i pionowy widok obrazów panoramicznych"
464
465 #: admin/partials/wpvr_documentation.php:1121
466 #: production/admin/partials/wpvr_documentation.php:1121
467 msgid "Convert any jpeg or png format image to webp on media upload:"
468 msgstr ""
469 "Konwertuj dowolny obraz w formacie JPEG lub PNG na WebP podczas przesyłania "
470 "multimediów:"
471
472 #: admin/classes/class-wpvr-general.php:138
473 #: production/admin/classes/class-wpvr-general.php:138
474 msgid "Create a tour use this QR code"
475 msgstr "Utwórz wycieczkę Użyj tego kodu QR"
476
477 #: admin/partials/wpvr_documentation.php:245
478 #: production/admin/partials/wpvr_documentation.php:245
479 msgid ""
480 "Create high-converting slaes funnels on a visual drag & drop funnel builder "
481 "canvas and increase your online sales from today."
482 msgstr ""
483 "Twórz ścieżki SLAES o wysokim konwersji na wizualnym kanwie konstruktora "
484 "lejka przeci�
485 gnij i upuść i zwiększ sprzedaż online od dzisiaj."
486
487 #: admin/classes/class-wpvr-meta-field.php:1677
488 #: production/admin/classes/class-wpvr-meta-field.php:1677
489 msgid "Cubemap"
490 msgstr "Mapa słowna"
491
492 #: admin/partials/wpvr_documentation.php:515
493 #: production/admin/partials/wpvr_documentation.php:515
494 msgid "Cubemap Image Support"
495 msgstr "Obsługa obrazów CubeMap"
496
497 #: admin/partials/wpvr_setup_wizard.php:75
498 #: production/admin/partials/wpvr_setup_wizard.php:75
499 msgid "Cubemap Images"
500 msgstr "Obrazy z map�
501 "
502
503 #: admin/partials/wpvr_setup_wizard.php:155
504 #: production/admin/partials/wpvr_setup_wizard.php:155
505 #| msgid "Custom control buttons"
506 msgid "Custom Control Buttons"
507 msgstr "Niestandardowe przyciski sterowania"
508
509 #: admin/classes/class-wpvr-meta-field.php:478
510 #: production/admin/classes/class-wpvr-meta-field.php:478
511 msgid "Custom CSS"
512 msgstr "Niestandardowe CSS"
513
514 #: admin/classes/class-wpvr-meta-field.php:305
515 #: production/admin/classes/class-wpvr-meta-field.php:305
516 msgid "Custom CSS "
517 msgstr "Niestandardowe CSS"
518
519 #: admin/partials/wpvr_documentation.php:446
520 #: production/admin/partials/wpvr_documentation.php:446
521 msgid "Custom Icon & Color for Hotspots (Using CSS)"
522 msgstr "Niestandardowa ikona i kolor dla hotspotów (przy użyciu CSS)"
523
524 #: admin/classes/class-wpvr-meta-field.php:2771
525 #: production/admin/classes/class-wpvr-meta-field.php:2771
526 msgid ""
527 "Custom icons will only show on frontend. Hotspot custom icons only works "
528 "with fontawesome 5. If you are using any different version of fontawesome "
529 "under theme or any plugin, you may deactivate fontawesome from WP VR. Go to "
530 "\"Get Started menu\" and select \"Role\" and check fontawesome disable "
531 "switch. Now put your desired any icon class under \"Hotspot custom icon "
532 "class\" field. It will appear on the frontend."
533 msgstr ""
534 "Niestandardowe ikony będ�
535 wyświetlane tylko na frontend. Niestandardowe "
536 "ikony Hotspot działa tylko z FontaWesome 5. Jeśli używasz innej wersji "
537 "FontaWesome pod motywem lub jak�
538 kolwiek wtyczk�
539 , możesz dezaktywować "
540 "FontaWesome z WP VR. Przejdź do \"Menu Rozpocznij\" i wybierz \"Role\" i "
541 "zaznacz FontaWesome Disable Switch. Teraz umieść ż�
542 dan�
543 klasę ikon w polu "
544 "„Hotspot Custom Icon Class”. Pojawi się na froncie."
545
546 #: admin/partials/wpvr_documentation.php:679
547 #: production/admin/partials/wpvr_documentation.php:679
548 msgid "Custom Panorama Loading Face"
549 msgstr "Niestandardowa twarz ładuj�
550 ca panoramę"
551
552 #: admin/partials/wpvr_documentation.php:595
553 #: production/admin/partials/wpvr_documentation.php:595
554 msgid "Custom Preview Image & Text"
555 msgstr "Niestandardowy obraz podgl�
556 du i tekst"
557
558 #: admin/partials/wpvr_documentation.php:569
559 #: production/admin/partials/wpvr_documentation.php:569
560 msgid "Custom Rotation Settings"
561 msgstr "Niestandardowe ustawienia rotacji"
562
563 #: admin/partials/wpvr_documentation.php:665
564 #: production/admin/partials/wpvr_documentation.php:665
565 msgid "Custom Zoom Settings"
566 msgstr "Niestandardowe ustawienia powiększenia"
567
568 #: admin/partials/wpvr_documentation.php:754
569 #: production/admin/partials/wpvr_documentation.php:754
570 msgid "Customize Icon & Logo of Control Buttons."
571 msgstr "Dostosuj ikonę i logo przycisków sterowania."
572
573 #: admin/partials/wpvr_license.php:34
574 #: production/admin/partials/wpvr_license.php:34
575 msgid "Deactivate License"
576 msgstr "Dezaktywuj licencję"
577
578 #: admin/partials/wpvr_setup_wizard.php:125
579 #: production/admin/partials/wpvr_setup_wizard.php:125
580 msgid "Decisions"
581 msgstr "decyzja"
582
583 #: admin/partials/wpvr_documentation.php:873
584 #: production/admin/partials/wpvr_documentation.php:873
585 msgid "Disable Fontawesome from WP VR:"
586 msgstr "Wył�
587 cz FontaWesome z WP VR:"
588
589 #: admin/classes/class-wpvr-meta-field.php:252
590 #: production/admin/classes/class-wpvr-meta-field.php:252
591 msgid "Disable keyboard control to use the form."
592 msgstr "Wył�
593 cz kontrolę klawiatury, aby użyć formularza."
594
595 #: admin/partials/wpvr_documentation.php:951
596 #: production/admin/partials/wpvr_documentation.php:951
597 msgid "Disable On Hover Content for Mobile:"
598 msgstr "Wył�
599 cz zawartość najechania na telefon komórkowy:"
600
601 #: admin/partials/wpvr_documentation.php:925
602 #: production/admin/partials/wpvr_documentation.php:925
603 msgid "Disable WordPress Large Image Handler on WP VR:"
604 msgstr "Wył�
605 cz duży program obsługi obrazów WordPress na WP VR:"
606
607 #: admin/partials/wpvr_documentation.php:782
608 #: production/admin/partials/wpvr_documentation.php:782
609 msgid ""
610 "Do not close or refresh the page during import process. It may take few "
611 "minutes."
612 msgstr ""
613 "Nie zamykaj ani nie odświeżaj strony podczas procesu importowania. Może to "
614 "zaj�
615 ć kilka minut."
616
617 #: admin/class-wpvr-admin.php:291 admin/partials/wpvr_documentation.php:203
618 #: admin/partials/wpvr_documentation.php:207
619 #: production/admin/class-wpvr-admin.php:290
620 #: production/admin/partials/wpvr_documentation.php:203
621 #: production/admin/partials/wpvr_documentation.php:207
622 msgid "Documentation"
623 msgstr "dokumentacja"
624
625 #: admin/classes/class-wpvr-meta-field.php:1365
626 #: production/admin/classes/class-wpvr-meta-field.php:1365
627 msgid "Documentation "
628 msgstr "dokumentacja"
629
630 #: admin/classes/class-tour-guide-translation.php:10
631 #: production/admin/classes/class-tour-guide-translation.php:10
632 msgid "Done"
633 msgstr "spełniony"
634
635 #: admin/classes/class-wpvr-general.php:143
636 #: production/admin/classes/class-wpvr-general.php:143
637 msgid "Download QR Code"
638 msgstr "pobierz kod QR"
639
640 #: admin/partials/wpvr_documentation.php:637
641 #: production/admin/partials/wpvr_documentation.php:637
642 msgid "Duplicate Tours with One Click"
643 msgstr "Powiel wycieczki za jednym kliknięciem"
644
645 #: admin/partials/wpvr_documentation.php:842
646 #: production/admin/partials/wpvr_documentation.php:842
647 msgid ""
648 "Editors will be able to Create, Edit, Update, and Delete all virtual tours."
649 msgstr ""
650 "Edytorzy będ�
651 mogli tworzyć, edytować, aktualizować i usuwać wszystkie "
652 "wirtualne wycieczki."
653
654 #: admin/classes/class-wpvr-meta-field.php:741
655 #: production/admin/classes/class-wpvr-meta-field.php:741
656 msgid "Enable explainer video"
657 msgstr "Wł�
658 cz wideo wyjaśniaj�
659 ce"
660
661 #: admin/partials/wpvr_documentation.php:899
662 #: production/admin/partials/wpvr_documentation.php:899
663 msgid "Enable mobile media resizer:"
664 msgstr "Wł�
665 cz zmianę rozmiaru nośników mobilnych:"
666
667 #: admin/partials/wpvr_documentation.php:726
668 #: production/admin/partials/wpvr_documentation.php:726
669 msgid "Enable or Disable Keyboard Movement Control."
670 msgstr "Wł�
671 cz lub wył�
672 cz kontrolę ruchu klawiatury."
673
674 #: admin/partials/wpvr_documentation.php:730
675 #: production/admin/partials/wpvr_documentation.php:730
676 msgid "Enable or Disable Keyboard Zoom Control."
677 msgstr "Wł�
678 cz lub wył�
679 cz kontrolę zoomu klawiatury."
680
681 #: admin/partials/wpvr_documentation.php:734
682 #: production/admin/partials/wpvr_documentation.php:734
683 msgid "Enable or Disable Mouse Drag Control."
684 msgstr "Wł�
685 cz lub wył�
686 cz kontrolę przeci�
687 gania myszy."
688
689 #: admin/partials/wpvr_documentation.php:738
690 #: production/admin/partials/wpvr_documentation.php:738
691 msgid "Enable or Disable Mouse Zoom control."
692 msgstr "Wł�
693 cz lub wył�
694 cz kontrolę zoomu myszy."
695
696 #: admin/partials/wpvr_documentation.php:978
697 #: production/admin/partials/wpvr_documentation.php:978
698 msgid ""
699 "Enable script control (It will load the WP VR scripts on the pages with "
700 "virtual tours only):"
701 msgstr ""
702 "Wł�
703 cz kontrolę skryptów (załaduje skrypty WP VR na stronach tylko z "
704 "wirtualnymi wycieczkami):"
705
706 #: admin/classes/class-wpvr-general.php:121
707 #: production/admin/classes/class-wpvr-general.php:121
708 msgid "Enable Social Media Share"
709 msgstr "Wł�
710 cz udostępnianie w mediach społecznościowych"
711
712 #: admin/classes/class-wpvr-meta-field.php:281
713 #: production/admin/classes/class-wpvr-meta-field.php:281
714 msgid "Enable the call to action, it will render under the tour."
715 msgstr "Wł�
716 cz wezwanie do działania, zostanie wyrenderowane w ramach trasy."
717
718 #: admin/classes/class-wpvr-meta-field.php:1583
719 #: production/admin/classes/class-wpvr-meta-field.php:1583
720 msgid "Enable Video"
721 msgstr "Wł�
722 cz wideo"
723
724 #: admin/partials/wpvr_documentation.php:1018
725 #: production/admin/partials/wpvr_documentation.php:1018
726 msgid ""
727 "Enable Video JS control (It will load the WP VR Video JS library in the "
728 "listed pages only):"
729 msgstr ""
730 "Wł�
731 cz kontrolę wideo JS (załaduje bibliotekę WP VR Video JS tylko na "
732 "wymienionych stronach):"
733
734 #: admin/classes/class-tour-guide-translation.php:11
735 #: production/admin/classes/class-tour-guide-translation.php:11
736 msgid "End Tour"
737 msgstr "koniec wycieczki"
738
739 #: admin/partials/wpvr_license.php:22
740 #: production/admin/partials/wpvr_license.php:22
741 msgid "Enter your license key, save changes and activate."
742 msgstr "Wprowadź klucz licencyjny, zapisz zmiany i aktywuj."
743
744 #: admin/classes/class-wpvr-meta-field.php:1676
745 #: production/admin/classes/class-wpvr-meta-field.php:1676
746 msgid "Equirectangular"
747 msgstr "równowartościowy"
748
749 #: admin/classes/class-wpvr-meta-field.php:845
750 #: production/admin/classes/class-wpvr-meta-field.php:845
751 msgid "Explainer"
752 msgstr "wyjaśniacz"
753
754 #: admin/partials/wpvr_documentation.php:390
755 #: admin/partials/wpvr_setup_wizard.php:176
756 #: production/admin/partials/wpvr_documentation.php:390
757 #: production/admin/partials/wpvr_setup_wizard.php:176
758 msgid "Explainer Video"
759 msgstr "Wyjaśnienie wideo"
760
761 #: admin/classes/class-wpvr-meta-field.php:618
762 #: production/admin/classes/class-wpvr-meta-field.php:618
763 msgid "Export"
764 msgstr "eksportowy"
765
766 #: admin/partials/wpvr_documentation.php:301
767 #: production/admin/partials/wpvr_documentation.php:301
768 msgid "features"
769 msgstr "zarzut"
770
771 #: admin/partials/wpvr_setup_wizard.php:125
772 #: production/admin/partials/wpvr_setup_wizard.php:125
773 msgid "Features That Can"
774 msgstr "Funkcje, które mog�
775 "
776
777 #: admin/partials/wpvr_documentation.php:1064
778 #: production/admin/partials/wpvr_documentation.php:1064
779 msgid "Flip the phone to landscape mode for a better experience of the tour."
780 msgstr "Przesuń telefon w tryb poziomy, aby uzyskać lepsze wrażenia z trasy."
781
782 #: admin/partials/wpvr_documentation.php:542
783 #: production/admin/partials/wpvr_documentation.php:542
784 msgid "Fluent Forms Add-on"
785 msgstr "Dodatek Fluent Forms"
786
787 #: admin/partials/wpvr_setup_wizard.php:11
788 #: production/admin/partials/wpvr_setup_wizard.php:11
789 msgid "Follow the Guided Wizard and Learn How it Works."
790 msgstr ""
791 "Postępuj zgodnie z przewodnikiem kreatora i dowiedz się, jak to działa."
792
793 #: admin/classes/class-wpvr-meta-field.php:3037
794 #: production/admin/classes/class-wpvr-meta-field.php:3037
795 msgid "Font color"
796 msgstr "kolor czcionki"
797
798 #: admin/classes/class-wpvr-meta-field.php:3042
799 #: production/admin/classes/class-wpvr-meta-field.php:3042
800 msgid "Font Size (px)"
801 msgstr "Rozmiar czcionki (PX)"
802
803 #: admin/classes/class-wpvr-meta-field.php:3094
804 #: production/admin/classes/class-wpvr-meta-field.php:3094
805 msgid "Font Style"
806 msgstr "Styl czcionki"
807
808 #: admin/classes/class-wpvr-meta-field.php:3047
809 #: production/admin/classes/class-wpvr-meta-field.php:3047
810 msgid "Font Weight"
811 msgstr "Waga czcion"
812
813 #: admin/partials/wpvr_setup_wizard.php:10
814 #: production/admin/partials/wpvr_setup_wizard.php:10
815 msgid "for Choosing"
816 msgstr "za wybór"
817
818 #: admin/classes/class-wpvr-shortcode.php:36
819 #: production/admin/classes/class-wpvr-shortcode.php:36
820 #| msgid "For classic editor:"
821 msgid "For Classic Editor:"
822 msgstr "Dla klasycznego edytora:"
823
824 #: admin/partials/wpvr_setup_wizard.php:194
825 #: production/admin/partials/wpvr_setup_wizard.php:194
826 msgid "for unlimited virtual tours."
827 msgstr "dla nieograniczonej wirtualnej wycieczki."
828
829 #: admin/partials/wpvr_setup_wizard.php:43
830 #: production/admin/partials/wpvr_setup_wizard.php:43
831 msgid "for Virtual Tours, Viewing Panoramas, and 360 Degree Content"
832 msgstr ""
833 "W przypadku wirtualnych wycieczek, przegl�
834 dania panoram i zawartości 360 "
835 "stopni"
836
837 #: admin/partials/wpvr_documentation.php:302
838 #: production/admin/partials/wpvr_documentation.php:302
839 msgid "free"
840 msgstr "bezpłatny"
841
842 #: admin/partials/wpvr_documentation.php:121
843 #: production/admin/partials/wpvr_documentation.php:121
844 msgid "Free vs Pro"
845 msgstr "darmowe vs pro"
846
847 #: admin/partials/wpvr_documentation.php:1067
848 #: production/admin/partials/wpvr_documentation.php:1067
849 msgid "Front-End Notice for Mobile Visitors:"
850 msgstr "Powiadomienie z front-end dla użytkowników mobilnych:"
851
852 #: admin/partials/wpvr_documentation.php:582
853 #: production/admin/partials/wpvr_documentation.php:582
854 msgid "Full Page Virtual Tours"
855 msgstr "Wirtualne wycieczki na całej stronie"
856
857 #: admin/classes/class-wpvr-meta-field.php:826
858 #: production/admin/classes/class-wpvr-meta-field.php:826
859 msgid "Full Screen"
860 msgstr "pełny ekran"
861
862 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:132
863 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:133
864 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:132
865 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:133
866 msgid "Fullwidth"
867 msgstr "pełna szerokość"
868
869 #: admin/classes/class-wpvr-meta-field.php:106
870 #: production/admin/classes/class-wpvr-meta-field.php:106
871 msgid "General"
872 msgstr "gromadny"
873
874 #: admin/partials/wpvr_documentation.php:800
875 #: production/admin/partials/wpvr_documentation.php:800
876 msgid "General Setup Options"
877 msgstr "Ogólne opcje konfiguracji"
878
879 #: admin/classes/class-wpvr-meta-field.php:247
880 #: production/admin/classes/class-wpvr-meta-field.php:247
881 msgid "Generic Form"
882 msgstr "Formularz ogólny"
883
884 #: admin/partials/wpvr_setup_wizard.php:193
885 #: production/admin/partials/wpvr_setup_wizard.php:193
886 msgid "Get Access to "
887 msgstr "Uzyskaj dostęp do"
888
889 #: admin/partials/wpvr_documentation.php:247
890 #: admin/partials/wpvr_documentation.php:262
891 #: production/admin/partials/wpvr_documentation.php:247
892 #: production/admin/partials/wpvr_documentation.php:262
893 msgid "Get It Now"
894 msgstr "Pobierz to teraz"
895
896 #: admin/partials/wpvr_setup_wizard.php:197
897 #: production/admin/partials/wpvr_setup_wizard.php:197
898 msgid "Get Pro Now"
899 msgstr "Zdob�
900 dź profesjonalistę"
901
902 #: admin/class-wpvr-admin.php:286 admin/classes/class-wpvr-admin-pages.php:68
903 #: admin/classes/class-wpvr-admin-pages.php:76
904 #: production/admin/class-wpvr-admin.php:285
905 #: production/admin/classes/class-wpvr-admin-pages.php:68
906 #: production/admin/classes/class-wpvr-admin-pages.php:76
907 msgid "Get Started"
908 msgstr "rozpocz�
909 ć"
910
911 #: admin/classes/class-tour-guide-translation.php:14
912 #: production/admin/classes/class-tour-guide-translation.php:14
913 msgid "Give a name to your virtual tour."
914 msgstr "Nadaj nazwę swojej wirtualnej trasie."
915
916 #: admin/class-wpvr-admin.php:298 admin/classes/class-wpvr-admin-pages.php:84
917 #: production/admin/class-wpvr-admin.php:297
918 #: production/admin/classes/class-wpvr-admin-pages.php:84
919 msgid "Go Pro"
920 msgstr "zostać pro"
921
922 #: admin/partials/wpvr_documentation.php:502
923 #: admin/partials/wpvr_setup_wizard.php:99
924 #: production/admin/partials/wpvr_documentation.php:502
925 #: production/admin/partials/wpvr_setup_wizard.php:99
926 msgid "Google Street View"
927 msgstr "Widok ulicy Google"
928
929 #: admin/classes/class-wpvr-admin-pages.php:75
930 #: production/admin/classes/class-wpvr-admin-pages.php:75
931 msgid "Guided Tour"
932 msgstr "wycieczka z przewodnikiem"
933
934 #: admin/classes/class-wpvr-meta-field.php:832
935 #: production/admin/classes/class-wpvr-meta-field.php:832
936 msgid "Gyroscope"
937 msgstr "giroskop"
938
939 #: admin/partials/wpvr_setup_wizard.php:183
940 #: production/admin/partials/wpvr_setup_wizard.php:183
941 msgid "Gyroscope & Mobile Notices"
942 msgstr "Powiadomienia o żyroskopie i urz�
943 dzeniach mobilnych"
944
945 #: admin/classes/class-wpvr-meta-field.php:672
946 #: production/admin/classes/class-wpvr-meta-field.php:672
947 msgid "Gyroscope Control"
948 msgstr "Sterowanie żyroskopem"
949
950 #: admin/partials/wpvr_documentation.php:363
951 #: production/admin/partials/wpvr_documentation.php:363
952 #| msgid "Gyroscope support"
953 msgid "Gyroscope Support"
954 msgstr "Wsparcie żyroskopu"
955
956 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:147
957 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:147
958 msgid "Height"
959 msgstr "zenit"
960
961 #: oxygen/elements/Wpvr_Tour_Element.php:51
962 #: production/oxygen/elements/Wpvr_Tour_Element.php:51
963 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:155
964 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:156
965 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:155
966 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:156
967 msgid "Height Unit"
968 msgstr "Wysokość"
969
970 #: elementor/elements/Wpvr-widget.php:175
971 #: production/elementor/elements/Wpvr-widget.php:175
972 msgid "Height:"
973 msgstr "Wysokość:"
974
975 #: admin/classes/class-tour-guide-translation.php:31
976 #: production/admin/classes/class-tour-guide-translation.php:31
977 msgid ""
978 "Here is a preview of your panorama image in tour mode. You can control it "
979 "and mode around to see it in 360 degree view."
980 msgstr ""
981 "Oto podgl�
982 d Twojego obrazu panoramy w trybie wycieczki. Możesz nim sterować "
983 "i trybu wokół, aby zobaczyć go w widoku 360 stopni."
984
985 #: admin/classes/class-tour-guide-translation.php:60
986 #: admin/classes/class-tour-guide-translation.php:64
987 #: production/admin/classes/class-tour-guide-translation.php:60
988 #: production/admin/classes/class-tour-guide-translation.php:64
989 msgid "Here you can see the Pitch & Yaw has been set for the hotspot."
990 msgstr "Tutaj możesz zobaczyć, że boisko i Yaw zostało ustawione dla hotspotu."
991
992 #: admin/classes/class-tour-guide-translation.php:68
993 #: admin/classes/class-tour-guide-translation.php:72
994 #: production/admin/classes/class-tour-guide-translation.php:68
995 #: production/admin/classes/class-tour-guide-translation.php:72
996 msgid ""
997 "Here, you can set what content your viewer will see after clicking on the "
998 "Hotspot. You can either set an URL or any other content using this editor. "
999 "To learn more, follow this guide to set content using editor"
1000 msgstr ""
1001 "Tutaj możesz ustawić, jakie treści zobaczy Twój widz po kliknięciu w hotspot."
1002 " Możesz ustawić adres URL lub inn�
1003 zawartość za pomoc�
1004 tego edytora. Aby "
1005 "dowiedzieć się więcej, postępuj zgodnie z tym przewodnikiem, aby ustawić "
1006 "zawartość za pomoc�
1007 edytora"
1008
1009 #: admin/classes/class-wpvr-meta-field.php:838
1010 #: production/admin/classes/class-wpvr-meta-field.php:838
1011 msgid "Home"
1012 msgstr "ojczyzna"
1013
1014 #: admin/partials/wpvr_documentation.php:714
1015 #: production/admin/partials/wpvr_documentation.php:714
1016 msgid "Home Button to visit Default Scene"
1017 msgstr "Przycisk Home, aby odwiedzić domyśln�
1018 scenę"
1019
1020 #: admin/partials/wpvr_setup_wizard.php:125
1021 #: production/admin/partials/wpvr_setup_wizard.php:125
1022 msgid "Hook"
1023 msgstr "uczepić"
1024
1025 #: admin/classes/class-wpvr-meta-field.php:97
1026 #: production/admin/classes/class-wpvr-meta-field.php:97
1027 msgid "Hotspot"
1028 msgstr "gor�
1029 cy miejsce"
1030
1031 #: admin/classes/class-wpvr-meta-field.php:978
1032 #: production/admin/classes/class-wpvr-meta-field.php:978
1033 msgid "Hotspot Custom Icon Class"
1034 msgstr "Niestandardowa klasa ikon Hotspot"
1035
1036 #: admin/classes/class-wpvr-meta-field.php:957
1037 #: production/admin/classes/class-wpvr-meta-field.php:957
1038 msgid "Hotspot ID"
1039 msgstr "Identyfikator hotspotu"
1040
1041 #: admin/classes/class-wpvr-hotspot.php:109
1042 #: admin/classes/class-wpvr-hotspot.php:169
1043 #: production/admin/classes/class-wpvr-hotspot.php:109
1044 #: production/admin/classes/class-wpvr-hotspot.php:169
1045 msgid "Hotspot Setting"
1046 msgstr "Ustawienie hotspotu"
1047
1048 #: admin/classes/class-wpvr-meta-field.php:999
1049 #: admin/classes/class-wpvr-meta-field.php:1055
1050 #: admin/classes/class-wpvr-meta-field.php:1116
1051 #: admin/classes/class-wpvr-meta-field.php:1182
1052 #: admin/classes/class-wpvr-meta-field.php:1248
1053 #: production/admin/classes/class-wpvr-meta-field.php:999
1054 #: production/admin/classes/class-wpvr-meta-field.php:1055
1055 #: production/admin/classes/class-wpvr-meta-field.php:1116
1056 #: production/admin/classes/class-wpvr-meta-field.php:1182
1057 #: production/admin/classes/class-wpvr-meta-field.php:1248
1058 msgid "Hotspot-Type"
1059 msgstr "Hotspot-typ"
1060
1061 #. Author URI of the plugin
1062 msgid "http://rextheme.com/"
1063 msgstr "http://rextheme.com/"
1064
1065 #. URI of the plugin
1066 msgid "https://rextheme.com/wpvr/"
1067 msgstr "https://rextheme.com/wpvr/"
1068
1069 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:91
1070 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:91
1071 msgid "ID"
1072 msgstr "dowód osobisty"
1073
1074 #: elementor/elements/Wpvr-widget.php:157
1075 #: production/elementor/elements/Wpvr-widget.php:157
1076 msgid "ID:"
1077 msgstr "ID:"
1078
1079 #: admin/classes/class-wpvr-meta-field.php:683
1080 #: production/admin/classes/class-wpvr-meta-field.php:683
1081 msgid ""
1082 "If set to true, device orientation control will be used when the panorama is "
1083 "loaded, if the device supports it. If false, device orientation control "
1084 "needs to be activated by pressing a button. Defaults to false. Will work if "
1085 "gyroscope is enabled"
1086 msgstr ""
1087 "Jeśli ustawione na true, kontrola orientacji urz�
1088 dzenia będzie używana, gdy "
1089 "panorama jest załadowana, jeśli urz�
1090 dzenie j�
1091 obsługuje. Jeśli false, "
1092 "kontrola orientacji urz�
1093 dzenia musi być aktywowana przez naciśnięcie "
1094 "przycisku. domyślnie na false. będzie działać, jeśli żyroskop jest wł�
1095 czony"
1096
1097 #: admin/partials/wpvr_documentation.php:137
1098 #: production/admin/partials/wpvr_documentation.php:137
1099 msgid "Import"
1100 msgstr "znaczyć"
1101
1102 #: admin/partials/wpvr_documentation.php:623
1103 #: production/admin/partials/wpvr_documentation.php:623
1104 msgid "Import & Export Virtual Tours"
1105 msgstr "Import i eksport wirtualne wycieczki"
1106
1107 #: admin/partials/wpvr_documentation.php:778
1108 #: production/admin/partials/wpvr_documentation.php:778
1109 msgid "Import tour file: "
1110 msgstr "Importuj plik wycieczki:"
1111
1112 #: admin/classes/class-tour-guide-translation.php:52
1113 #: production/admin/classes/class-tour-guide-translation.php:52
1114 msgid ""
1115 "In this Preview, drag to your desired location and click on it, exactly "
1116 "where you want to set the hotspot"
1117 msgstr ""
1118 "W tym podgl�
1119 dzie przeci�
1120 gnij do ż�
1121 danej lokalizacji i kliknij j�
1122 , dokładnie "
1123 "tam, gdzie chcesz ustawić hotspot"
1124
1125 #: admin/partials/wpvr_documentation.php:97
1126 #: production/admin/partials/wpvr_documentation.php:97
1127 msgid "Info"
1128 msgstr "info"
1129
1130 #: admin/partials/wpvr_documentation.php:418
1131 #: production/admin/partials/wpvr_documentation.php:418
1132 msgid "Info-type Hotspots (Heading, Image, Text, Video, Gif, Links)"
1133 msgstr "Hotspoty typu info (nagłówek, obraz, tekst, wideo, GIF, linki)"
1134
1135 #: admin/classes/class-wpvr-meta-field.php:3097
1136 #: production/admin/classes/class-wpvr-meta-field.php:3097
1137 msgid "Italic"
1138 msgstr "italski"
1139
1140 #: admin/classes/class-wpvr-meta-field.php:3089
1141 #: production/admin/classes/class-wpvr-meta-field.php:3089
1142 msgid "Justified"
1143 msgstr "usprawiedliwiony"
1144
1145 #: admin/classes/class-wpvr-meta-field.php:640
1146 #: production/admin/classes/class-wpvr-meta-field.php:640
1147 msgid "Keyboard Movement Control"
1148 msgstr "Kontrola ruchu klawiatury"
1149
1150 #: admin/classes/class-wpvr-meta-field.php:648
1151 #: production/admin/classes/class-wpvr-meta-field.php:648
1152 msgid "Keyboard Zoom Control"
1153 msgstr "Kontrola zoomu klawiatury"
1154
1155 #: admin/partials/wpvr_setup_wizard.php:54
1156 #: admin/partials/wpvr_setup_wizard.php:66
1157 #: admin/partials/wpvr_setup_wizard.php:78
1158 #: admin/partials/wpvr_setup_wizard.php:90
1159 #: admin/partials/wpvr_setup_wizard.php:102
1160 #: production/admin/partials/wpvr_setup_wizard.php:54
1161 #: production/admin/partials/wpvr_setup_wizard.php:66
1162 #: production/admin/partials/wpvr_setup_wizard.php:78
1163 #: production/admin/partials/wpvr_setup_wizard.php:90
1164 #: production/admin/partials/wpvr_setup_wizard.php:102
1165 msgid "Learn more"
1166 msgstr "Więcej"
1167
1168 #: admin/classes/class-wpvr-meta-field.php:3086
1169 #: admin/classes/class-wpvr-meta-field.php:3161
1170 #: production/admin/classes/class-wpvr-meta-field.php:3086
1171 #: production/admin/classes/class-wpvr-meta-field.php:3161
1172 msgid "Left"
1173 msgstr "lewo"
1174
1175 #: admin/classes/class-tour-guide-translation.php:43
1176 #: production/admin/classes/class-tour-guide-translation.php:43
1177 msgid "Let's add a Hotspot"
1178 msgstr "Dodajmy hotspot"
1179
1180 #: admin/classes/class-wpvr-meta-field.php:3103
1181 #: production/admin/classes/class-wpvr-meta-field.php:3103
1182 msgid "Letter Spacing (px)"
1183 msgstr "Rozstaw liter (PX)"
1184
1185 #: admin/partials/wpvr_license.php:18
1186 #: production/admin/partials/wpvr_license.php:18
1187 msgid "License Key"
1188 msgstr "klucz licencyjny"
1189
1190 #: admin/classes/class-wpvr-meta-field.php:3059
1191 #: production/admin/classes/class-wpvr-meta-field.php:3059
1192 msgid "Line Height"
1193 msgstr "Wysokość linii"
1194
1195 #: admin/classes/class-wpvr-meta-field.php:3069
1196 #: production/admin/classes/class-wpvr-meta-field.php:3069
1197 msgid "Line Through"
1198 msgstr "przejechać"
1199
1200 #: admin/partials/wpvr_documentation.php:1004
1201 #: production/admin/partials/wpvr_documentation.php:1004
1202 msgid ""
1203 "List of allowed pages to load WP VR scripts (The URLs of the pages on your "
1204 "site with virtual tours):"
1205 msgstr ""
1206 "Lista dozwolonych stron do załadowania skryptów WP VR (adresy URL stron w "
1207 "Twojej witrynie z wirtualnymi wycieczkami):"
1208
1209 #: admin/partials/wpvr_documentation.php:1044
1210 #: production/admin/partials/wpvr_documentation.php:1044
1211 msgid ""
1212 "List of allowed pages to load WP VR Video JS library (The URLs of the pages "
1213 "on your site, You want to load Video JS):"
1214 msgstr ""
1215 "Lista dozwolonych stron do załadowania biblioteki WP VR Video JS (adresy URL "
1216 "stron w Twojej witrynie, chcesz załadować wideo JS):"
1217
1218 #: admin/partials/wpvr_documentation.php:1050
1219 #: production/admin/partials/wpvr_documentation.php:1050
1220 msgid ""
1221 "List the pages like this: https://example.com/tour1/, https://example."
1222 "com/tour2/"
1223 msgstr ""
1224 "Wymień strony w następuj�
1225 cy sposób: https://example.com/tour1/, https:"
1226 "//example.com/tour2/"
1227
1228 #: admin/partials/wpvr_documentation.php:1010
1229 #: production/admin/partials/wpvr_documentation.php:1010
1230 msgid ""
1231 "List the pages with virtual tours like this: https://example.com/tour1/, "
1232 "https://example.com/tour2/"
1233 msgstr ""
1234 "Wymień strony z wirtualnymi wycieczkami w następuj�
1235 cy sposób: https:"
1236 "//example.com/tour1/, https://example.com/tour2/"
1237
1238 #: admin/classes/class-wpvr-meta-field.php:3078
1239 #: production/admin/classes/class-wpvr-meta-field.php:3078
1240 msgid "Lowercase"
1241 msgstr "małe litery"
1242
1243 #: admin/partials/wpvr_documentation.php:227
1244 #: production/admin/partials/wpvr_documentation.php:227
1245 msgid "Make WPVR Popular"
1246 msgstr "Spraw, aby WPVR był popularny"
1247
1248 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:192
1249 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:192
1250 msgid "Mobile Height"
1251 msgstr "Wysokość mobilna"
1252
1253 #: oxygen/elements/Wpvr_Tour_Element.php:118
1254 #: production/oxygen/elements/Wpvr_Tour_Element.php:118
1255 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:200
1256 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:201
1257 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:200
1258 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:201
1259 msgid "Mobile Height Unit"
1260 msgstr "Mobilna jednostka wysokości"
1261
1262 #: admin/partials/wpvr_setup_wizard.php:63
1263 #: production/admin/partials/wpvr_setup_wizard.php:63
1264 msgid "Mobile Panorama"
1265 msgstr "Mobilna panorama"
1266
1267 #: admin/partials/wpvr_documentation.php:710
1268 #: production/admin/partials/wpvr_documentation.php:710
1269 msgid "More Pro Features"
1270 msgstr "Więcej funkcji Pro"
1271
1272 #: admin/partials/wpvr_documentation.php:742
1273 #: production/admin/partials/wpvr_documentation.php:742
1274 msgid "Mouse Control."
1275 msgstr "Kontrola myszy."
1276
1277 #: admin/classes/class-wpvr-meta-field.php:656
1278 #: production/admin/classes/class-wpvr-meta-field.php:656
1279 msgid "Mouse Drag Control"
1280 msgstr "Kontrola przeci�
1281 gania myszy"
1282
1283 #: admin/classes/class-wpvr-meta-field.php:664
1284 #: production/admin/classes/class-wpvr-meta-field.php:664
1285 msgid "Mouse Zoom Control"
1286 msgstr "Kontrola zoomu myszy"
1287
1288 #: admin/classes/class-wpvr-meta-field.php:783
1289 #: production/admin/classes/class-wpvr-meta-field.php:783
1290 msgid "Move Down"
1291 msgstr "opuszczać"
1292
1293 #: admin/classes/class-wpvr-meta-field.php:789
1294 #: production/admin/classes/class-wpvr-meta-field.php:789
1295 msgid "Move Left"
1296 msgstr "Przesuń się w lewo"
1297
1298 #: admin/classes/class-wpvr-meta-field.php:795
1299 #: production/admin/classes/class-wpvr-meta-field.php:795
1300 msgid "Move Right"
1301 msgstr "Ruszaj w prawo"
1302
1303 #: admin/classes/class-wpvr-meta-field.php:777
1304 #: production/admin/classes/class-wpvr-meta-field.php:777
1305 msgid "Move Up"
1306 msgstr "podnieść"
1307
1308 #: admin/partials/wpvr_setup_wizard.php:148
1309 #: production/admin/partials/wpvr_setup_wizard.php:148
1310 msgid "Multiple Content on Hotspots"
1311 msgstr "Wiele treści w hotspotach"
1312
1313 #: admin/classes/class-tour-guide-translation.php:8
1314 #: production/admin/classes/class-tour-guide-translation.php:8
1315 msgid "Next"
1316 msgstr "prawie"
1317
1318 #: admin/classes/class-wpvr-meta-field.php:1651
1319 #: admin/partials/wpvr_confirmation_alert.php:26
1320 #: production/admin/classes/class-wpvr-meta-field.php:1651
1321 #: production/admin/partials/wpvr_confirmation_alert.php:26
1322 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:137
1323 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:137
1324 msgid "No"
1325 msgstr "bynajm"
1326
1327 #: admin/classes/class-wpvr-meta-field.php:3066
1328 #: admin/classes/class-wpvr-meta-field.php:3076
1329 #: production/admin/classes/class-wpvr-meta-field.php:3066
1330 #: production/admin/classes/class-wpvr-meta-field.php:3076
1331 msgid "None"
1332 msgstr "żaden"
1333
1334 #: admin/classes/class-wpvr-meta-field.php:3096
1335 #: production/admin/classes/class-wpvr-meta-field.php:3096
1336 msgid "Normal"
1337 msgstr "normalny"
1338
1339 #: admin/classes/class-wpvr-general.php:101
1340 #: production/admin/classes/class-wpvr-general.php:101
1341 msgid ""
1342 "Note: WooCommerce &amp; Fluent Forms hotspots will not be supported on "
1343 "embedded tours."
1344 msgstr ""
1345 "Uwaga: Hotspoty WooCommerce & Amp; Fluent Forms Hotspoty nie będ�
1346 "
1347 "obsługiwane podczas wycieczek osadzonych."
1348
1349 #: admin/classes/class-wpvr-meta-field.php:3098
1350 #: production/admin/classes/class-wpvr-meta-field.php:3098
1351 msgid "Oblique"
1352 msgstr "skośny"
1353
1354 #: oxygen/elements/Wpvr_Tour_Element.php:89
1355 #: production/oxygen/elements/Wpvr_Tour_Element.php:89
1356 msgid "OFF"
1357 msgstr "opodal"
1358
1359 #: oxygen/elements/Wpvr_Tour_Element.php:88
1360 #: production/oxygen/elements/Wpvr_Tour_Element.php:88
1361 msgid "ON"
1362 msgstr "przez"
1363
1364 #: admin/classes/class-wpvr-meta-field.php:1016
1365 #: admin/classes/class-wpvr-meta-field.php:1072
1366 #: admin/classes/class-wpvr-meta-field.php:1139
1367 #: admin/classes/class-wpvr-meta-field.php:1205
1368 #: admin/classes/class-wpvr-meta-field.php:1265
1369 #: production/admin/classes/class-wpvr-meta-field.php:1016
1370 #: production/admin/classes/class-wpvr-meta-field.php:1072
1371 #: production/admin/classes/class-wpvr-meta-field.php:1139
1372 #: production/admin/classes/class-wpvr-meta-field.php:1205
1373 #: production/admin/classes/class-wpvr-meta-field.php:1265
1374 msgid "On Click Content"
1375 msgstr "Przy kliknięciu treści"
1376
1377 #: admin/classes/class-wpvr-meta-field.php:1021
1378 #: admin/classes/class-wpvr-meta-field.php:1079
1379 #: admin/classes/class-wpvr-meta-field.php:1146
1380 #: admin/classes/class-wpvr-meta-field.php:1212
1381 #: admin/classes/class-wpvr-meta-field.php:1271
1382 #: production/admin/classes/class-wpvr-meta-field.php:1021
1383 #: production/admin/classes/class-wpvr-meta-field.php:1079
1384 #: production/admin/classes/class-wpvr-meta-field.php:1146
1385 #: production/admin/classes/class-wpvr-meta-field.php:1212
1386 #: production/admin/classes/class-wpvr-meta-field.php:1271
1387 msgid "On Hover Content"
1388 msgstr "Na najechaniu zawartości"
1389
1390 #: admin/partials/wpvr_documentation.php:746
1391 #: production/admin/partials/wpvr_documentation.php:746
1392 msgid "On Screen Compass."
1393 msgstr "Kompas na ekranie."
1394
1395 #: admin/classes/class-tour-guide-translation.php:56
1396 #: production/admin/classes/class-tour-guide-translation.php:56
1397 msgid ""
1398 "Once you see the Pitch & Yaw value for the spot, click on this Arrow. It'll "
1399 "be set as the coordinate for your hotspot"
1400 msgstr ""
1401 "Gdy zobaczysz wartość Pitch & Yaw dla miejsca, kliknij tę strzałkę. zostanie "
1402 "ustawiony jako współrzędna dla twojego hotspotu"
1403
1404 #: wpvr.php:261 production/wpvr.php:261
1405 #: public/classes/class-wpvr-shortcode.php:98
1406 #: production/public/classes/class-wpvr-shortcode.php:98
1407 msgid ""
1408 "Oops! It seems like this post isn't published yet. Stay tuned for updates!"
1409 msgstr ""
1410 "Ups! Wygl�
1411 da na to, że ten post nie został jeszcze opublikowany. B�
1412 dź na "
1413 "bież�
1414 co z aktualizacjami!"
1415
1416 #: admin/classes/class-wpvr-meta-field.php:3025
1417 #: production/admin/classes/class-wpvr-meta-field.php:3025
1418 msgid "Open in new tab"
1419 msgstr "Otwórz w nowej karcie"
1420
1421 #: admin/classes/class-wpvr-meta-field.php:1009
1422 #: admin/classes/class-wpvr-meta-field.php:1065
1423 #: admin/classes/class-wpvr-meta-field.php:1132
1424 #: admin/classes/class-wpvr-meta-field.php:1198
1425 #: admin/classes/class-wpvr-meta-field.php:1258
1426 #: production/admin/classes/class-wpvr-meta-field.php:1009
1427 #: production/admin/classes/class-wpvr-meta-field.php:1065
1428 #: production/admin/classes/class-wpvr-meta-field.php:1132
1429 #: production/admin/classes/class-wpvr-meta-field.php:1198
1430 #: production/admin/classes/class-wpvr-meta-field.php:1258
1431 msgid "Open in same tab"
1432 msgstr "Otwórz w tej samej karcie"
1433
1434 #: admin/classes/class-wpvr-meta-field.php:3068
1435 #: production/admin/classes/class-wpvr-meta-field.php:3068
1436 msgid "Overline"
1437 msgstr "wyci�
1438 ć"
1439
1440 #: admin/classes/class-wpvr-meta-field.php:3143
1441 #: production/admin/classes/class-wpvr-meta-field.php:3143
1442 msgid "Padding (px)"
1443 msgstr "Wyściółka (PX)"
1444
1445 #: admin/partials/wpvr_documentation.php:377
1446 #: admin/partials/wpvr_setup_wizard.php:134
1447 #: production/admin/partials/wpvr_documentation.php:377
1448 #: production/admin/partials/wpvr_setup_wizard.php:134
1449 msgid "Panorama Scene Gallery"
1450 msgstr "Galeria scen panoramicznych"
1451
1452 #: admin/partials/wpvr_documentation.php:474
1453 #: production/admin/partials/wpvr_documentation.php:474
1454 msgid "Partial Panorama / Mobile Panorama Support"
1455 msgstr "Częściowa Panorama / Mobilna Panorama Wsparcie"
1456
1457 #: admin/classes/class-wpvr-meta-field.php:1606
1458 #: production/admin/classes/class-wpvr-meta-field.php:1606
1459 msgid "Paste Youtube or Vimeo link or upload"
1460 msgstr "Wklej link do YouTube lub Vimeo lub prześlij"
1461
1462 #: admin/classes/class-wpvr-ajax.php:375
1463 #: production/admin/classes/class-wpvr-ajax.php:375
1464 msgid "Permission check failed"
1465 msgstr "Sprawdzanie uprawnień nie powi"
1466
1467 #: admin/partials/wpvr_setup_wizard.php:126
1468 #: production/admin/partials/wpvr_setup_wizard.php:126
1469 msgid "Personalize your virtual tours, in the way you want."
1470 msgstr "Spersonalizuj swoje wirtualne wycieczki w sposób, w jaki chcesz."
1471
1472 #: admin/classes/class-wpvr-meta-field.php:964
1473 #: production/admin/classes/class-wpvr-meta-field.php:964
1474 msgid "Pitch"
1475 msgstr "wystawiać towar"
1476
1477 #: admin/classes/class-tour-guide-translation.php:59
1478 #: admin/classes/class-tour-guide-translation.php:63
1479 #: production/admin/classes/class-tour-guide-translation.php:59
1480 #: production/admin/classes/class-tour-guide-translation.php:63
1481 msgid "Pitch & Yaw is Set"
1482 msgstr "Pitch & Yaw jest ustawiony"
1483
1484 #: admin/partials/wpvr_documentation.php:219
1485 #: production/admin/partials/wpvr_documentation.php:219
1486 msgid "Post a Ticket"
1487 msgstr "Opublikuj bilet"
1488
1489 #: admin/partials/wpvr_setup_wizard.php:193
1490 #: production/admin/partials/wpvr_setup_wizard.php:193
1491 msgid "Premium Features"
1492 msgstr "Funkcje premium"
1493
1494 #: admin/classes/class-tour-preview-meta-box.php:853
1495 #: production/admin/classes/class-tour-preview-meta-box.php:853
1496 msgid "Preview"
1497 msgstr "prapremiera"
1498
1499 #: admin/classes/class-wpvr-meta-field.php:146
1500 #: production/admin/classes/class-wpvr-meta-field.php:146
1501 msgid "Preview Image Message"
1502 msgstr "Wyświetl wiadomość obrazkow�
1503 "
1504
1505 #: admin/classes/class-tour-guide-translation.php:26
1506 #: production/admin/classes/class-tour-guide-translation.php:26
1507 msgid "Preview The Image in Tour Mode"
1508 msgstr "Podgl�
1509 d obrazu w trybie wycieczki"
1510
1511 #: admin/classes/class-tour-guide-translation.php:75
1512 #: production/admin/classes/class-tour-guide-translation.php:75
1513 msgid "Preview Your Hotspot Content"
1514 msgstr "Wyświetl podgl�
1515 d zawartości Hotspot"
1516
1517 #: admin/classes/class-tour-guide-translation.php:9
1518 #: production/admin/classes/class-tour-guide-translation.php:9
1519 msgid "Previous"
1520 msgstr "dawny"
1521
1522 #: admin/classes/class-wpvr-meta-field.php:432
1523 #: admin/classes/class-wpvr-meta-field.php:466
1524 #: production/admin/classes/class-wpvr-meta-field.php:432
1525 #: production/admin/classes/class-wpvr-meta-field.php:466
1526 msgid "Print the forms shortcode you want to show."
1527 msgstr "Wydrukuj formularze Shortcode, które chcesz wyświetlić."
1528
1529 #: admin/partials/wpvr_documentation.php:303
1530 #: production/admin/partials/wpvr_documentation.php:303
1531 msgid "pro"
1532 msgstr "zawodowiec"
1533
1534 #: admin/partials/wpvr_documentation.php:335
1535 #: production/admin/partials/wpvr_documentation.php:335
1536 msgid "Publish Tours Anywhere (Embed Add-on)"
1537 msgstr "Publikuj wycieczki w dowolnym miejscu (dodatk do osadzenia)"
1538
1539 #: admin/classes/class-tour-guide-translation.php:38
1540 #: production/admin/classes/class-tour-guide-translation.php:38
1541 msgid "Publish Your Tour"
1542 msgstr "Opublikuj swoj�
1543 wycieczkę"
1544
1545 #: elementor/elements/Wpvr-widget.php:178
1546 #: production/elementor/elements/Wpvr-widget.php:178
1547 msgid "Put value in (px)"
1548 msgstr "Wpisz wartość w (px)"
1549
1550 #: oxygen/elements/Wpvr_Tour_Element.php:56
1551 #: oxygen/elements/Wpvr_Tour_Element.php:76
1552 #: oxygen/elements/Wpvr_Tour_Element.php:106
1553 #: oxygen/elements/Wpvr_Tour_Element.php:123
1554 #: production/oxygen/elements/Wpvr_Tour_Element.php:56
1555 #: production/oxygen/elements/Wpvr_Tour_Element.php:76
1556 #: production/oxygen/elements/Wpvr_Tour_Element.php:106
1557 #: production/oxygen/elements/Wpvr_Tour_Element.php:123
1558 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:118
1559 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:159
1560 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:182
1561 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:204
1562 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:118
1563 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:159
1564 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:182
1565 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:204
1566 msgid "px"
1567 msgstr "ermodrale"
1568
1569 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:170
1570 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:170
1571 msgid "Radius"
1572 msgstr "promień"
1573
1574 #: oxygen/elements/Wpvr_Tour_Element.php:101
1575 #: production/oxygen/elements/Wpvr_Tour_Element.php:101
1576 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:178
1577 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:179
1578 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:178
1579 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:179
1580 msgid "Radius Unit"
1581 msgstr "Jednostka promienia"
1582
1583 #: elementor/elements/Wpvr-widget.php:185
1584 #: production/elementor/elements/Wpvr-widget.php:185
1585 msgid "Radius:"
1586 msgstr "Promień:"
1587
1588 #: admin/partials/wpvr_documentation.php:231
1589 #: production/admin/partials/wpvr_documentation.php:231
1590 #| msgid "Rate Us! "
1591 msgid "Rate Us "
1592 msgstr "Oceń nas"
1593
1594 #: admin/partials/wpvr_setup_wizard.php:218
1595 #: production/admin/partials/wpvr_setup_wizard.php:218
1596 msgid "Read Documentations"
1597 msgstr "Przeczytaj dokumentację"
1598
1599 #: admin/partials/wpvr_setup_wizard.php:219
1600 #: production/admin/partials/wpvr_setup_wizard.php:219
1601 msgid "Read Our Complete Guides"
1602 msgstr "Przeczytaj nasze kompletne przewodniki"
1603
1604 #: admin/partials/wpvr_documentation.php:260
1605 #: production/admin/partials/wpvr_documentation.php:260
1606 msgid ""
1607 "Recover abandoned carts with automated email drip campaigns. Start getting "
1608 "back lost sales on your online store."
1609 msgstr ""
1610 "Odzyskiwanie porzuconych koszyków dzięki zautomatyzowanym kampaniom "
1611 "kroplowym. Zacznij odzyskiwać utracon�
1612 sprzedaż w swoim sklepie internetowym."
1613
1614 #: admin/classes/class-wpvr-meta-field.php:403
1615 #: production/admin/classes/class-wpvr-meta-field.php:403
1616 msgid "Resume Auto-rotation after"
1617 msgstr "Wznów automatyczne obracanie po"
1618
1619 #. Author of the plugin
1620 msgid "Rextheme"
1621 msgstr "rekstemet"
1622
1623 #: admin/classes/class-wpvr-meta-field.php:3087
1624 #: admin/classes/class-wpvr-meta-field.php:3151
1625 #: production/admin/classes/class-wpvr-meta-field.php:3087
1626 #: production/admin/classes/class-wpvr-meta-field.php:3151
1627 msgid "Right"
1628 msgstr "w porz�
1629 dku"
1630
1631 #: admin/classes/class-wpvr-meta-field.php:394
1632 #: production/admin/classes/class-wpvr-meta-field.php:394
1633 msgid "Rotation Speed and Direction"
1634 msgstr "Prędkość obrotowa i kierunek"
1635
1636 #: admin/partials/wpvr_documentation.php:1172
1637 #: production/admin/partials/wpvr_documentation.php:1172
1638 msgid "Save"
1639 msgstr "uratować"
1640
1641 #: admin/classes/class-tour-guide-translation.php:79
1642 #: production/admin/classes/class-tour-guide-translation.php:79
1643 msgid "Save Your Progress"
1644 msgstr "Zapisz swoje postępy"
1645
1646 #: admin/classes/class-tour-guide-translation.php:34
1647 #: production/admin/classes/class-tour-guide-translation.php:34
1648 msgid "Save Your Tour"
1649 msgstr "Zapisz swoj�
1650 wycieczkę"
1651
1652 #: admin/partials/wpvr_documentation.php:722
1653 #: production/admin/partials/wpvr_documentation.php:722
1654 msgid "Scene Author with URL"
1655 msgstr "Autor sceny z adresem URL"
1656
1657 #: admin/classes/class-wpvr-meta-field.php:209
1658 #: production/admin/classes/class-wpvr-meta-field.php:209
1659 msgid "Scene Fade Duration"
1660 msgstr "Czas trwania zanikania sceny"
1661
1662 #: admin/classes/class-wpvr-meta-field.php:709
1663 #: production/admin/classes/class-wpvr-meta-field.php:709
1664 msgid "Scene Gallery"
1665 msgstr "Galeria scen"
1666
1667 #: admin/classes/class-wpvr-meta-field.php:873
1668 #: admin/classes/class-wpvr-meta-field.php:921
1669 #: production/admin/classes/class-wpvr-meta-field.php:873
1670 #: production/admin/classes/class-wpvr-meta-field.php:921
1671 msgid "Scene ID"
1672 msgstr "Identyfikator scen"
1673
1674 #: admin/classes/class-wpvr-meta-field.php:725
1675 #: production/admin/classes/class-wpvr-meta-field.php:725
1676 msgid "Scene Navigation Menu"
1677 msgstr "Menu nawigacji sceny"
1678
1679 #: admin/classes/class-wpvr-scene.php:233
1680 #: admin/classes/class-wpvr-scene.php:262
1681 #: production/admin/classes/class-wpvr-scene.php:233
1682 #: production/admin/classes/class-wpvr-scene.php:262
1683 msgid "Scene Setting"
1684 msgstr "Ustawienie sceny"
1685
1686 #: admin/partials/wpvr_documentation.php:718
1687 #: production/admin/partials/wpvr_documentation.php:718
1688 msgid "Scene Title"
1689 msgstr "Tytuł sceny"
1690
1691 #: admin/classes/class-wpvr-meta-field.php:717
1692 #: production/admin/classes/class-wpvr-meta-field.php:717
1693 msgid "Scene Titles on Gallery"
1694 msgstr "Tytuły scen w galerii"
1695
1696 #: admin/partials/wpvr_documentation.php:750
1697 #: production/admin/partials/wpvr_documentation.php:750
1698 msgid "Scene Titles on Gallery."
1699 msgstr "Tytuły scen w galerii."
1700
1701 #: admin/classes/class-wpvr-meta-field.php:881
1702 #: admin/classes/class-wpvr-meta-field.php:929
1703 #: production/admin/classes/class-wpvr-meta-field.php:881
1704 #: production/admin/classes/class-wpvr-meta-field.php:929
1705 msgid "Scene Type"
1706 msgstr "Typ sceny"
1707
1708 #: admin/classes/class-wpvr-meta-field.php:888
1709 #: admin/classes/class-wpvr-meta-field.php:936
1710 #: production/admin/classes/class-wpvr-meta-field.php:888
1711 #: production/admin/classes/class-wpvr-meta-field.php:936
1712 msgid "Scene Upload"
1713 msgstr "Przesyłanie sceny"
1714
1715 #: admin/classes/class-wpvr-meta-field.php:1774
1716 #: production/admin/classes/class-wpvr-meta-field.php:1774
1717 msgid "Scene Upload: "
1718 msgstr "Przesyłanie sceny:"
1719
1720 #: admin/partials/wpvr_documentation.php:432
1721 #: production/admin/partials/wpvr_documentation.php:432
1722 msgid "Scene-type Hotspots (Connect Panoramas)"
1723 msgstr "Hotspoty typu sceny (Poł�
1724 cz panoramy)"
1725
1726 #: admin/classes/class-wpvr-meta-field.php:88
1727 #: production/admin/classes/class-wpvr-meta-field.php:88
1728 msgid "Scenes"
1729 msgstr "scenki"
1730
1731 #: admin/partials/wpvr_documentation.php:1150
1732 #: production/admin/partials/wpvr_documentation.php:1150
1733 msgid "Select a Version to Rollback"
1734 msgstr "Wybierz wersję do wycofania"
1735
1736 #: admin/classes/class-wpvr-meta-field.php:1025
1737 #: admin/classes/class-wpvr-meta-field.php:1085
1738 #: admin/classes/class-wpvr-meta-field.php:1152
1739 #: admin/classes/class-wpvr-meta-field.php:1218
1740 #: admin/classes/class-wpvr-meta-field.php:1277
1741 #: production/admin/classes/class-wpvr-meta-field.php:1025
1742 #: production/admin/classes/class-wpvr-meta-field.php:1085
1743 #: production/admin/classes/class-wpvr-meta-field.php:1152
1744 #: production/admin/classes/class-wpvr-meta-field.php:1218
1745 #: production/admin/classes/class-wpvr-meta-field.php:1277
1746 msgid "Select Target Scene from List"
1747 msgstr "Wybierz scenę docelow�
1748 z listy"
1749
1750 #: admin/classes/class-wpvr-meta-field.php:1120
1751 #: admin/classes/class-wpvr-meta-field.php:1186
1752 #: production/admin/classes/class-wpvr-meta-field.php:1120
1753 #: production/admin/classes/class-wpvr-meta-field.php:1186
1754 msgid "Select your form"
1755 msgstr "Wybierz swój formularz"
1756
1757 #: admin/partials/wpvr_setup_wizard.php:141
1758 #: production/admin/partials/wpvr_setup_wizard.php:141
1759 msgid "Sell WooCommerce Products"
1760 msgstr "Sprzedawaj produkty WooCommerce"
1761
1762 #: admin/classes/class-wpvr-meta-field.php:417
1763 #: production/admin/classes/class-wpvr-meta-field.php:417
1764 msgid ""
1765 "Set a time after which auto rotation will stop. Assign in milliseconds, "
1766 "where 1000 milliseconds = 1 second."
1767 msgstr ""
1768 "Ustaw czas, po którym zatrzyma się automatyczna obrót. Przypisz w "
1769 "milisekundach, gdzie 1000 milisekund = 1 sekunda."
1770
1771 #: admin/classes/class-tour-guide-translation.php:13
1772 #: production/admin/classes/class-tour-guide-translation.php:13
1773 msgid "Set a Title to Your Virtual Tour"
1774 msgstr "Ustaw tytuł na swoj�
1775 wirtualn�
1776 wycieczkę"
1777
1778 #: admin/classes/class-wpvr-meta-field.php:140
1779 #: production/admin/classes/class-wpvr-meta-field.php:140
1780 msgid "Set a Tour Preview Image"
1781 msgstr "Ustaw obraz podgl�
1782 du wycieczki"
1783
1784 #: admin/classes/class-wpvr-meta-field.php:399
1785 #: production/admin/classes/class-wpvr-meta-field.php:399
1786 msgid ""
1787 "Set a value to determine the speed of rotation. The higher the number, the "
1788 "faster it will rotate. Positive values will make it rotate clockwise and "
1789 "negative values will make it rotate anti clockwise"
1790 msgstr ""
1791 "Ustaw wartość, aby określić prędkość obrotu. Im wyższa liczba, tym szybciej "
1792 "się obraca. Dodatnie wartości sprawi�
1793 , że obróci się zgodnie z ruchem "
1794 "wskazówek zegara, a wartości ujemne sprawi�
1795 , że obróci się przeciwnie do "
1796 "ruchu"
1797
1798 #: admin/classes/class-tour-guide-translation.php:48
1799 #: production/admin/classes/class-tour-guide-translation.php:48
1800 msgid ""
1801 "Set an unique Hotspot ID to each of your Hotspots. Avoid Spaces & special "
1802 "characters. Set it like H1 or 01"
1803 msgstr ""
1804 "Ustaw unikalny identyfikator hotspotu dla każdego ze swoich hotspotów. "
1805 "Unikaj spacji i znaków specjalnych. Ustaw to jak h1 lub 01"
1806
1807 #: admin/classes/class-wpvr-meta-field.php:866
1808 #: admin/classes/class-wpvr-meta-field.php:914
1809 #: production/admin/classes/class-wpvr-meta-field.php:866
1810 #: production/admin/classes/class-wpvr-meta-field.php:914
1811 msgid "Set as Default"
1812 msgstr "Ustaw jako domyślny"
1813
1814 #: admin/partials/wpvr_setup_wizard.php:162
1815 #: production/admin/partials/wpvr_setup_wizard.php:162
1816 msgid "Set Contact Form"
1817 msgstr "Ustaw formularz kontaktowy"
1818
1819 #: admin/classes/class-tour-guide-translation.php:47
1820 #: production/admin/classes/class-tour-guide-translation.php:47
1821 msgid "Set Hotspot ID"
1822 msgstr "Ustaw identyfikator hotspotu"
1823
1824 #: admin/classes/class-tour-guide-translation.php:67
1825 #: admin/classes/class-tour-guide-translation.php:71
1826 #: production/admin/classes/class-tour-guide-translation.php:67
1827 #: production/admin/classes/class-tour-guide-translation.php:71
1828 msgid "Set The Content for Click Action"
1829 msgstr "Ustaw treść dla akcji kliknięcia"
1830
1831 #: admin/classes/class-tour-guide-translation.php:18
1832 #: production/admin/classes/class-tour-guide-translation.php:18
1833 msgid ""
1834 "Set the Scene ID for your first panorama image. The Scene ID has to be "
1835 "unique for each scene and without any spaces or special characters. You can "
1836 "set it as Scene1, S1, or simply 01."
1837 msgstr ""
1838 "Ustaw identyfikator sceny dla pierwszego obrazu panoramy. Identyfikator "
1839 "sceny musi być unikalny dla każdej sceny i bez spacji i znaków specjalnych. "
1840 "Możesz ustawić go jako Scene1, S1 lub po prostu 01."
1841
1842 #: admin/classes/class-wpvr-meta-field.php:749
1843 #: production/admin/classes/class-wpvr-meta-field.php:749
1844 msgid "Set Zoom Preferences"
1845 msgstr "Ustaw preferencje powiększenia"
1846
1847 #: admin/partials/wpvr_documentation.php:150
1848 #: production/admin/partials/wpvr_documentation.php:150
1849 msgid "Settings"
1850 msgstr "Ustawienie"
1851
1852 #: admin/class-wpvr-admin.php:268 production/admin/class-wpvr-admin.php:267
1853 msgid "Setup"
1854 msgstr "budowa ciała"
1855
1856 #: admin/partials/wpvr_documentation.php:174
1857 #: production/admin/partials/wpvr_documentation.php:174
1858 msgid "Share On"
1859 msgstr "dzielić na"
1860
1861 #: admin/classes/class-wpvr-general.php:116
1862 #: production/admin/classes/class-wpvr-general.php:116
1863 msgid "Share your tour"
1864 msgstr "Udostępnij swoj�
1865 wycieczkę"
1866
1867 #: wpvr.php:2647 production/wpvr.php:2647
1868 msgid ""
1869 "Since you have updated the plugin, please clear the browser cache for smooth "
1870 "functioning. Follow these steps if you are using <a href=\"https://support."
1871 "google.com/accounts/answer/32050?co=GENIE.Platform%3DDesktop&hl=en\" "
1872 "target=\"_blank\">Google Chrome</a>, <a href=\"https://support.mozilla."
1873 "org/en-US/kb/how-clear-firefox-cache\" target=\"_blank\">Mozilla Firefox</a>,"
1874 " <a href=\"https://clear-my-cache.com/en/apple-mac-os/safari.html\" "
1875 "target=\"_blank\">Safai</a> or <a href=\"https://support.microsoft.com/en-"
1876 "us/help/10607/microsoft-edge-view-delete-browser-history\" target=\"_blank\">"
1877 "Microsoft Edge</a>"
1878 msgstr ""
1879 "Ponieważ zaktualizowałeś wtyczkę, wyczyść pamięć podręczn�
1880 przegl�
1881 darki, aby "
1882 "zapewnić płynne działanie. Wykonaj następuj�
1883 ce kroki, jeśli używasz <a "
1884 "href=\"https://support.google.com/accounts/answer/32050?co=genie."
1885 "platform%3ddesktop&hl=pl\" target=\"_blank\">google chrome>, <a href=\"https:"
1886 "//supportull.molla.org/pl/s/how-clear-acre-cache chrome>, <a href=\"https:"
1887 "//www."
1888 "actactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactacktactactactactactactacregweltackactactactactactactactactactactactacregcik"
1889 "-acur-acreg-acrefur-acrefur-"
1890 "supckactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactawna"
1891 " lizak celour-"
1892 "actactactactactactactactactactactactactactactactactactactactactactactac"
1893
1894 #: admin/partials/wpvr_setup_wizard.php:194
1895 #: production/admin/partials/wpvr_setup_wizard.php:194
1896 msgid "Starts from only"
1897 msgstr "zaczyna się tylko od"
1898
1899 #: admin/classes/class-wpvr-meta-field.php:412
1900 #: production/admin/classes/class-wpvr-meta-field.php:412
1901 msgid "Stop Auto-rotation after"
1902 msgstr "Zatrzymaj automatyczne obracanie po"
1903
1904 #: admin/classes/class-wpvr-meta-field.php:3126
1905 #: production/admin/classes/class-wpvr-meta-field.php:3126
1906 msgid "Style"
1907 msgstr "wskazówka zegar"
1908
1909 #: admin/partials/wpvr_documentation.php:789
1910 #: production/admin/partials/wpvr_documentation.php:789
1911 msgid "Submit"
1912 msgstr "poddać pod"
1913
1914 #: admin/partials/wpvr_documentation.php:215
1915 #: production/admin/partials/wpvr_documentation.php:215
1916 msgid "Support"
1917 msgstr "dźwigać"
1918
1919 #: admin/partials/wpvr_setup_wizard.php:15
1920 #: admin/partials/wpvr_setup_wizard.php:205
1921 #: production/admin/partials/wpvr_setup_wizard.php:15
1922 #: production/admin/partials/wpvr_setup_wizard.php:205
1923 msgid "Take The Tour"
1924 msgstr "Weź udział w wycieczce"
1925
1926 #: admin/classes/class-wpvr-meta-field.php:1029
1927 #: admin/classes/class-wpvr-meta-field.php:1090
1928 #: admin/classes/class-wpvr-meta-field.php:1157
1929 #: admin/classes/class-wpvr-meta-field.php:1223
1930 #: admin/classes/class-wpvr-meta-field.php:1282
1931 #: production/admin/classes/class-wpvr-meta-field.php:1029
1932 #: production/admin/classes/class-wpvr-meta-field.php:1090
1933 #: production/admin/classes/class-wpvr-meta-field.php:1157
1934 #: production/admin/classes/class-wpvr-meta-field.php:1223
1935 #: production/admin/classes/class-wpvr-meta-field.php:1282
1936 msgid "Target Scene ID"
1937 msgstr "Identyfikator sceny docelowe"
1938
1939 #: admin/classes/class-wpvr-meta-field.php:3064
1940 #: production/admin/classes/class-wpvr-meta-field.php:3064
1941 msgid "Text Decoration"
1942 msgstr "Dekoracja tekstu"
1943
1944 #: admin/classes/class-wpvr-meta-field.php:3074
1945 #: production/admin/classes/class-wpvr-meta-field.php:3074
1946 msgid "Text Transform"
1947 msgstr "Przekształć tekst"
1948
1949 #: admin/partials/wpvr_setup_wizard.php:10
1950 #: production/admin/partials/wpvr_setup_wizard.php:10
1951 msgid "Thank you"
1952 msgstr "dziękuję"
1953
1954 #: admin/partials/wpvr_documentation.php:1088
1955 #: production/admin/partials/wpvr_documentation.php:1088
1956 msgid ""
1957 "The notice will appear on the front end of the virtual tour if viewed from a "
1958 "mobile device."
1959 msgstr ""
1960 "Powiadomienie pojawi się na przedniej części wirtualnej wycieczki, jeśli "
1961 "jest ogl�
1962 dane z urz�
1963 dzenia mobilnego."
1964
1965 #: admin/classes/class-wpvr-meta-field.php:163
1966 #: production/admin/classes/class-wpvr-meta-field.php:163
1967 msgid ""
1968 "This option will display Zoom In, Zoom Out and Full Screen buttons on the "
1969 "tour."
1970 msgstr ""
1971 "Ta opcja wyświetli przyciski powiększenia, pomniejszenia i pełnego ekranu "
1972 "podczas trasy."
1973
1974 #: admin/classes/class-wpvr-meta-field.php:2269
1975 #: production/admin/classes/class-wpvr-meta-field.php:2269
1976 msgid "This option will not work if the \"Tour Autoload\" is turned on."
1977 msgstr "Ta opcja nie zadziała, jeśli wł�
1978 czono „Tour Autoload”."
1979
1980 #: admin/classes/class-wpvr-meta-field.php:214
1981 #: production/admin/classes/class-wpvr-meta-field.php:214
1982 msgid "This will set the scene fade effect and execution time."
1983 msgstr "Spowoduje to ustawienie efektu zanikania sceny i czasu wykonania."
1984
1985 #: admin/classes/class-wpvr-general.php:95
1986 #: production/admin/classes/class-wpvr-general.php:95
1987 msgid "To Embed on External Page:"
1988 msgstr "Aby osadzić na zewnętrznej stronie:"
1989
1990 #: admin/classes/class-wpvr-shortcode.php:39
1991 #: production/admin/classes/class-wpvr-shortcode.php:39
1992 #| msgid ""
1993 #| "To use this Wpvr tour in your posts or pages use the following shortcode:"
1994 msgid ""
1995 "To use this WP VR tour in your posts or pages use the following shortcode "
1996 msgstr ""
1997 "Aby użyć tego WP VR Tour w swoich postach lub stronach, użyj następuj�
1998 cego "
1999 "skrótu kodu"
2000
2001 #: admin/classes/class-wpvr-meta-field.php:3146
2002 #: production/admin/classes/class-wpvr-meta-field.php:3146
2003 msgid "Top"
2004 msgstr "buda woz"
2005
2006 #: admin/classes/class-wpvr-meta-field.php:151
2007 #: production/admin/classes/class-wpvr-meta-field.php:151
2008 msgid "Tour Autoload"
2009 msgstr "Automatyczne ładowanie wycieczki"
2010
2011 #: admin/partials/wpvr_documentation.php:404
2012 #: production/admin/partials/wpvr_documentation.php:404
2013 msgid "Tour Background Audio"
2014 msgstr "Wycieczka dźwięk w tle"
2015
2016 #: admin/classes/class-wpvr-meta-field.php:733
2017 #: production/admin/classes/class-wpvr-meta-field.php:733
2018 msgid "Tour Background Music"
2019 msgstr "Muzyka w tle wycieczki"
2020
2021 #: admin/class-wpvr-admin.php:270 production/admin/class-wpvr-admin.php:269
2022 msgid "Tour Preview"
2023 msgstr "Podgl�
2024 d wycieczki"
2025
2026 #: admin/classes/class-wpvr-meta-field.php:154
2027 #: production/admin/classes/class-wpvr-meta-field.php:154
2028 msgid "Tour Preview Image will not appear if this is turned on."
2029 msgstr "Obraz podgl�
2030 du trasy nie pojawi się, jeśli jest wł�
2031 czony."
2032
2033 #: admin/classes/class-wpvr-admin-pages.php:71
2034 #: production/admin/classes/class-wpvr-admin-pages.php:71
2035 msgid "Tours"
2036 msgstr "wycieczki"
2037
2038 #: admin/classes/class-wpvr-meta-field.php:713
2039 #: admin/classes/class-wpvr-meta-field.php:729
2040 #: production/admin/classes/class-wpvr-meta-field.php:713
2041 #: production/admin/classes/class-wpvr-meta-field.php:729
2042 msgid ""
2043 "Turning it On will display a gallery with all the scenes on your tour. By "
2044 "double clicking on a scene thumbnail on the gallery, you can move to that "
2045 "specific scene. The gallery will only show up on the front end and not on "
2046 "the preview."
2047 msgstr ""
2048 "Wł�
2049 czenie go wyświetli galerię ze wszystkimi scenami podczas wycieczki. "
2050 "Dwukrotnie klikaj�
2051 c miniaturę sceny w galerii, możesz przejść do tej "
2052 "konkretnej sceny. Galeria pojawi się tylko na przedniej stronie, a nie na "
2053 "podgl�
2054 dzie."
2055
2056 #: admin/classes/class-wpvr-meta-field.php:721
2057 #: production/admin/classes/class-wpvr-meta-field.php:721
2058 msgid ""
2059 "Turning it on will display scene titles on each scene thumbnail inside the "
2060 "Scene Gallery. The Scene IDs will be used as the Scene Title."
2061 msgstr ""
2062 "Wł�
2063 czenie go spowoduje wyświetlenie tytułów scen na każdej miniaturze sceny "
2064 "w galerii sceny. Identyfikatory scen będ�
2065 używane jako tytuł sceny."
2066
2067 #: admin/class-wpvr-admin.php:215 production/admin/class-wpvr-admin.php:215
2068 msgid ""
2069 "Turning On The StreetView Option Will Erase Your Virtual Tour Data. Are You "
2070 "Sure?"
2071 msgstr ""
2072 "Wł�
2073 czenie opcji StreetView spowoduje usunięcie danych z wirtualnej wycieczki."
2074 " Czy na pewno?"
2075
2076 #: admin/class-wpvr-admin.php:214 production/admin/class-wpvr-admin.php:214
2077 msgid ""
2078 "Turning On The Video Option Will Erase Your Virtual Tour Data. Are You Sure?"
2079 msgstr ""
2080 "Wł�
2081 czenie opcji wideo usunie Twoje dane z wirtualnej wycieczki. Czy na pewno?"
2082
2083 #: admin/classes/class-wpvr-meta-field.php:3067
2084 #: production/admin/classes/class-wpvr-meta-field.php:3067
2085 msgid "Underline"
2086 msgstr "uwydatniać"
2087
2088 #: admin/partials/wpvr_documentation.php:321
2089 #: production/admin/partials/wpvr_documentation.php:321
2090 msgid "Unlimited Hotspots (Up to to 5 for a scene in free)"
2091 msgstr "Nieograniczone hotspoty (do 5 za scenę za darmo)"
2092
2093 #: admin/partials/wpvr_documentation.php:307
2094 #: production/admin/partials/wpvr_documentation.php:307
2095 msgid "Unlimited Scenes (Up to 5 in Free)"
2096 msgstr "Nieograniczone sceny (do 5 w darmowym)"
2097
2098 #: admin/partials/wpvr_setup_wizard.php:112
2099 #: production/admin/partials/wpvr_setup_wizard.php:112
2100 msgid "Unlock all these options by upgrading to Premium version"
2101 msgstr "Odblokuj wszystkie te opcje, aktualizuj�
2102 c wersję premium"
2103
2104 #: admin/partials/wpvr_setup_wizard.php:113
2105 #: production/admin/partials/wpvr_setup_wizard.php:113
2106 msgid "Upgrade Now"
2107 msgstr "Uaktualnij teraz"
2108
2109 #: admin/partials/wpvr_documentation.php:296
2110 #: admin/partials/wpvr_documentation.php:765
2111 #: production/admin/partials/wpvr_documentation.php:296
2112 #: production/admin/partials/wpvr_documentation.php:765
2113 msgid "Upgrade to Pro"
2114 msgstr "Uaktualnij do Pro"
2115
2116 #: admin/partials/wpvr_documentation.php:169
2117 #: admin/partials/wpvr_documentation.php:279
2118 #: admin/partials/wpvr_documentation.php:1178
2119 #: production/admin/partials/wpvr_documentation.php:169
2120 #: production/admin/partials/wpvr_documentation.php:279
2121 #: production/admin/partials/wpvr_documentation.php:1178
2122 #| msgid "Upgrade to pro"
2123 msgid "Upgrade to Pro "
2124 msgstr "Uaktualnij do Pro"
2125
2126 #: admin/classes/class-wpvr-meta-field.php:1605
2127 #: production/admin/classes/class-wpvr-meta-field.php:1605
2128 msgid "Upload or Add Link"
2129 msgstr "Prześlij lub dodaj link"
2130
2131 #: admin/classes/class-tour-guide-translation.php:21
2132 #: production/admin/classes/class-tour-guide-translation.php:21
2133 msgid "Upload Panorama Image"
2134 msgstr "Prześlij obraz panoramy"
2135
2136 #: admin/classes/class-wpvr-meta-field.php:3077
2137 #: production/admin/classes/class-wpvr-meta-field.php:3077
2138 msgid "Uppercase"
2139 msgstr "wielkie litery"
2140
2141 #: admin/classes/class-wpvr-meta-field.php:1003
2142 #: admin/classes/class-wpvr-meta-field.php:1059
2143 #: admin/classes/class-wpvr-meta-field.php:1126
2144 #: admin/classes/class-wpvr-meta-field.php:1192
2145 #: admin/classes/class-wpvr-meta-field.php:1252
2146 #: production/admin/classes/class-wpvr-meta-field.php:1003
2147 #: production/admin/classes/class-wpvr-meta-field.php:1059
2148 #: production/admin/classes/class-wpvr-meta-field.php:1126
2149 #: production/admin/classes/class-wpvr-meta-field.php:1192
2150 #: production/admin/classes/class-wpvr-meta-field.php:1252
2151 msgid "URL"
2152 msgstr "URL"
2153
2154 #: admin/classes/class-wpvr-general.php:99
2155 #: production/admin/classes/class-wpvr-general.php:99
2156 msgid "Use the iframe below to share this tour on an external page."
2157 msgstr ""
2158 "Użyj poniższej iframe, aby udostępnić tę wycieczkę na zewnętrznej stronie."
2159
2160 #: admin/classes/class-wpvr-general.php:89
2161 #: admin/classes/class-wpvr-shortcode.php:32
2162 #: production/admin/classes/class-wpvr-general.php:89
2163 #: production/admin/classes/class-wpvr-shortcode.php:32
2164 msgid "Using this Tour"
2165 msgstr "Korzystanie z tej wycieczki"
2166
2167 #: oxygen/elements/Wpvr_Tour_Element.php:57
2168 #: production/oxygen/elements/Wpvr_Tour_Element.php:57
2169 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:160
2170 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:160
2171 msgid "vh"
2172 msgstr "ves"
2173
2174 #: admin/classes/class-wpvr-meta-field.php:115
2175 #: production/admin/classes/class-wpvr-meta-field.php:115
2176 msgid "Video"
2177 msgstr "wideo"
2178
2179 #: admin/classes/class-wpvr-video.php:46
2180 #: production/admin/classes/class-wpvr-video.php:46
2181 msgid "Video Settings : "
2182 msgstr "Ustawienia wideo:"
2183
2184 #: admin/partials/wpvr_documentation.php:109
2185 #: production/admin/partials/wpvr_documentation.php:109
2186 msgid "Video Tutorials"
2187 msgstr "Samouczki wideo"
2188
2189 #: admin/partials/wpvr_documentation.php:528
2190 #: production/admin/partials/wpvr_documentation.php:528
2191 msgid "VR Glass Support for Video Tours"
2192 msgstr "Wsparcie VR Glass dla wideour wycieczek"
2193
2194 #: admin/partials/wpvr_documentation.php:1095
2195 #: production/admin/partials/wpvr_documentation.php:1095
2196 msgid "VR GLass Support:"
2197 msgstr "Wsparcie szkła VR:"
2198
2199 #: oxygen/elements/Wpvr_Tour_Element.php:78
2200 #: production/oxygen/elements/Wpvr_Tour_Element.php:78
2201 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:120
2202 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:120
2203 msgid "vw"
2204 msgstr "VW"
2205
2206 #: admin/classes/class-wpvr-meta-field.php:408
2207 #: production/admin/classes/class-wpvr-meta-field.php:408
2208 msgid ""
2209 "When someone clicks on the tour, auto-rotation stops. Here, set a time after "
2210 "which auto rotation will start again. Assign in milliseconds, where 1000 "
2211 "milliseconds = 1 second."
2212 msgstr ""
2213 "Gdy ktoś kliknie na trasę, automatyczne obracanie zatrzymuje się. Tutaj "
2214 "ustaw czas, po którym automatyczne obracanie rozpocznie się ponownie. "
2215 "Przypisz w milisekundach, gdzie 1000 milisekund = 1 sekunda."
2216
2217 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:103
2218 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:103
2219 msgid "Width"
2220 msgstr "szerokość"
2221
2222 #: admin/classes/class-wpvr-meta-field.php:3121
2223 #: production/admin/classes/class-wpvr-meta-field.php:3121
2224 msgid "Width (px)"
2225 msgstr "Szerokość (Px)"
2226
2227 #: oxygen/elements/Wpvr_Tour_Element.php:83
2228 #: production/oxygen/elements/Wpvr_Tour_Element.php:83
2229 msgid "Width Fullwidth"
2230 msgstr "szerokość pełna szerokość"
2231
2232 #: oxygen/elements/Wpvr_Tour_Element.php:70
2233 #: production/oxygen/elements/Wpvr_Tour_Element.php:70
2234 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:114
2235 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:115
2236 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:114
2237 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:115
2238 msgid "Width Unit"
2239 msgstr "Szerokość Jednostka"
2240
2241 #: elementor/elements/Wpvr-widget.php:165
2242 #: production/elementor/elements/Wpvr-widget.php:165
2243 msgid "Width:"
2244 msgstr "Szerokość:"
2245
2246 #: admin/partials/wpvr_documentation.php:1116
2247 #: production/admin/partials/wpvr_documentation.php:1116
2248 msgid ""
2249 "Will activate the VR Glass support on mobile devices. This is the Beta "
2250 "release. So, if you face any issues with it, please contact us at "
2251 "support@rextheme.com"
2252 msgstr ""
2253 "Aktywuje obsługę VR Glass na urz�
2254 dzeniach mobilnych. To jest wydanie beta. "
2255 "Jeśli więc napotkasz jakiekolwiek problemy z nim, skontaktuj się z nami pod "
2256 "adresem support@rextheme.com"
2257
2258 #: admin/partials/wpvr_documentation.php:1142
2259 #: production/admin/partials/wpvr_documentation.php:1142
2260 msgid ""
2261 "Will convert any jpeg or png image to webp format during media upload. will "
2262 "decrease the image size with no quality compromise and help the site to load "
2263 "faster."
2264 msgstr ""
2265 "Przekonwertuje dowolny obraz JPEG lub PNG na format WebP podczas przesyłania "
2266 "multimediów. Zmniejszy rozmiar obrazu bez kompromisów jakości i pomoże "
2267 "witrynie szybciej się ładować."
2268
2269 #: admin/partials/wpvr_documentation.php:349
2270 #: production/admin/partials/wpvr_documentation.php:349
2271 msgid "WooCommerce Add-on"
2272 msgstr "Dodatek WooCommerce"
2273
2274 #: admin/classes/class-wpvr-meta-field.php:3108
2275 #: production/admin/classes/class-wpvr-meta-field.php:3108
2276 msgid "Word Spacing (px)"
2277 msgstr "Odstępy słów (PX)"
2278
2279 #: admin/partials/wpvr_documentation.php:946
2280 #: production/admin/partials/wpvr_documentation.php:946
2281 msgid ""
2282 "WordPress's default large image handler for images larger than 2560px will "
2283 "be disabled for WP VR. So can create virtual tours with extremely high-"
2284 "quality images. Enabling it will also show high res image on mobile devices. "
2285 "Many devices may not support that resolution."
2286 msgstr ""
2287 "Domyślna obsługa obrazów WordPress dla dużych obrazów o większych niż 2560 "
2288 "pikseli zostanie wył�
2289 czona dla WP VR. Dzięki temu można tworzyć wirtualne "
2290 "wycieczki z niezwykle wysokiej jakości obrazami. Wł�
2291 czenie go również "
2292 "wyświetli obraz w wysokiej rozdzielczości na urz�
2293 dzeniach mobilnych. Wiele "
2294 "urz�
2295 dzeń może nie obsługiwać tej rozdzielczości."
2296
2297 #. Name of the plugin
2298 msgid "WP VR"
2299 msgstr "WP VR"
2300
2301 #. Description of the plugin
2302 msgid ""
2303 "WP VR - 360 Panorama and virtual tour creator for WordPress is a customized "
2304 "panaroma & virtual builder tool for WordPress Website."
2305 msgstr ""
2306 "WP VR - 360 Panorama i Virtual Tour Creator dla WordPress to dostosowane "
2307 "narzędzie Panaroma & Virtual Builder dla witryny WordPress."
2308
2309 #: admin/partials/wpvr_documentation.php:999
2310 #: admin/partials/wpvr_documentation.php:1039
2311 #: production/admin/partials/wpvr_documentation.php:999
2312 #: production/admin/partials/wpvr_documentation.php:1039
2313 msgid ""
2314 "WP VR assets will be loaded on your allowed pages only. If you turn this on, "
2315 "you have to list the URL's of the pages with virtual tours on the 'List of "
2316 "allowed pages to load WP VR scripts' option"
2317 msgstr ""
2318 "Zasoby WP VR będ�
2319 ładowane tylko na dozwolonych stronach. Jeśli to wł�
2320 czysz, "
2321 "musisz wyświetlić adresy URL stron z wirtualnymi wycieczkami na opcji „Lista "
2322 "dozwolonych stron do załadowania skryptów WP VR”"
2323
2324 #: admin/class-wpvr-rollback.php:160
2325 #: production/admin/class-wpvr-rollback.php:160
2326 msgid "WP VR Plugin Rollback"
2327 msgstr "Wtyczka WP VR Wycofanie wtyczki"
2328
2329 #: admin/partials/wpvr_documentation.php:894
2330 #: production/admin/partials/wpvr_documentation.php:894
2331 msgid "WP VR will not load Font Awesome library."
2332 msgstr "WP VR nie załaduje czcionki niesamowitej biblioteki."
2333
2334 #: admin/partials/wpvr_documentation.php:920
2335 #: production/admin/partials/wpvr_documentation.php:920
2336 msgid "WP VR will resize each scenes for mobile devices."
2337 msgstr "WP VR zmieni rozmiar każdej sceny na urz�
2338 dzenia mobilne."
2339
2340 #: admin/partials/wpvr_documentation.php:243
2341 #: production/admin/partials/wpvr_documentation.php:243
2342 msgid "WPFunnels"
2343 msgstr "WPFunnele"
2344
2345 #: elementor/elements/Wpvr-widget.php:44
2346 #: production/elementor/elements/Wpvr-widget.php:44
2347 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:21
2348 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:27
2349 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:21
2350 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:27
2351 #| msgid "Wpvr"
2352 msgid "WPVR"
2353 msgstr "WPVR"
2354
2355 #: admin/partials/wpvr_documentation.php:294
2356 #: production/admin/partials/wpvr_documentation.php:294
2357 msgid "WPVR Feature Comparison"
2358 msgstr "Porównanie funkcji WPVR"
2359
2360 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:148
2361 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:148
2362 msgid "WPVR Height"
2363 msgstr "Wysokość WPVR"
2364
2365 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:193
2366 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:193
2367 msgid "WPVR Mobile Height"
2368 msgstr "Wysokość mobilna WPVR"
2369
2370 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:171
2371 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:171
2372 msgid "WPVR Radius"
2373 msgstr "Promień WPVR"
2374
2375 #: elementor/elements/Wpvr-widget.php:146
2376 #: production/elementor/elements/Wpvr-widget.php:146
2377 #| msgid "Wpvr Setup"
2378 msgid "WPVR Setup"
2379 msgstr "Konfiguracja WPVR"
2380
2381 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:92
2382 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:92
2383 msgid "WPVR Tour ID"
2384 msgstr "Identyfikator trasy WPVR"
2385
2386 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:104
2387 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:104
2388 msgid "WPVR Width"
2389 msgstr "Szerokość WPVR"
2390
2391 #: admin/class-wpvr-admin.php:213 production/admin/class-wpvr-admin.php:213
2392 msgid "Write your css here"
2393 msgstr "Napisz tutaj swój CSS tutaj"
2394
2395 #: admin/classes/class-wpvr-meta-field.php:310
2396 #: production/admin/classes/class-wpvr-meta-field.php:310
2397 msgid "Write your custom css"
2398 msgstr "Napisz swój niestandardowy CSS"
2399
2400 #: admin/classes/class-wpvr-meta-field.php:971
2401 #: production/admin/classes/class-wpvr-meta-field.php:971
2402 msgid "Yaw"
2403 msgstr "schodzić z kursu"
2404
2405 #: admin/classes/class-wpvr-meta-field.php:1650
2406 #: admin/partials/wpvr_confirmation_alert.php:29
2407 #: production/admin/classes/class-wpvr-meta-field.php:1650
2408 #: production/admin/partials/wpvr_confirmation_alert.php:29
2409 #: includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:136
2410 #: production/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:136
2411 msgid "Yes"
2412 msgstr "ba"
2413
2414 #: admin/partials/wpvr_documentation.php:972
2415 #: production/admin/partials/wpvr_documentation.php:972
2416 msgid ""
2417 "You can disable on hover content for mobile devices. As most of the devices "
2418 "are touch based."
2419 msgstr ""
2420 "Możesz wył�
2421 czyć zawartość najechania na urz�
2422 dzeniach mobilnych. Ponieważ "
2423 "większość urz�
2424 dzeń jest opartych na dotyku."
2425
2426 #: admin/classes/class-wpvr-meta-field.php:1783
2427 #: admin/classes/class-wpvr-meta-field.php:1818
2428 #: production/admin/classes/class-wpvr-meta-field.php:1783
2429 #: production/admin/classes/class-wpvr-meta-field.php:1818
2430 msgid ""
2431 "You can use any image size but maximum image upload size recommended to "
2432 "support all device is 4096x2000 px for perfect responsive view. To check 360 "
2433 "view, click on preview button and check tour preview metabox."
2434 msgstr ""
2435 "Możesz użyć dowolnego rozmiaru obrazu, ale maksymalny rozmiar przesyłania "
2436 "obrazu zalecany do obsługi wszystkich urz�
2437 dzeń to 4096x2000 pikseli, aby "
2438 "uzyskać doskonały responsywny widok. Aby sprawdzić widok 360, kliknij "
2439 "przycisk Podgl�
2440 d i sprawdź Metabox podgl�
2441 du wycieczki."
2442
2443 #: admin/classes/class-tour-guide-translation.php:30
2444 #: production/admin/classes/class-tour-guide-translation.php:30
2445 msgid "Your Image In Tour Mode"
2446 msgstr "Twój obraz w trybie wycieczki"
2447
2448 #: admin/partials/wpvr_documentation.php:230
2449 #: production/admin/partials/wpvr_documentation.php:230
2450 msgid ""
2451 "Your rating and feedback matters to us. If you are happy with WP VR - 360 "
2452 "Panorama and virtual tour creator for WordPress give us a rating."
2453 msgstr ""
2454 "Twoja ocena i opinie s�
2455 dla nas ważne. Jeśli jesteś zadowolony z WP VR - 360 "
2456 "Panorama i Virtual Tour Creator dla WordPress, daj nam ocenę."
2457
2458 #: admin/partials/wpvr_setup_wizard.php:125
2459 #: production/admin/partials/wpvr_setup_wizard.php:125
2460 msgid "Your Viewers - And Make Them Take"
2461 msgstr "Twoi widzowie - i spraw, aby zabrali"
2462
2463 #: admin/classes/class-wpvr-meta-field.php:801
2464 #: production/admin/classes/class-wpvr-meta-field.php:801
2465 msgid "Zoom In"
2466 msgstr "pomakżyć"
2467
2468 #: admin/classes/class-wpvr-meta-field.php:752
2469 #: production/admin/classes/class-wpvr-meta-field.php:752
2470 msgid ""
2471 "Zoom interval is 50 to 120 degree. You can put any value between 50 to 120. "
2472 "As an example, if you set 100, the scene will display with zoom in 100 "
2473 "degree on each load."
2474 msgstr ""
2475 "Odstęp powiększenia wynosi od 50 do 120 stopni. Możesz umieścić dowoln�
2476 "
2477 "wartość od 50 do 120. Na przykład, jeśli ustawisz 100, scena będzie "
2478 "wyświetlana z powiększeniem w 100 stopni przy każdym obci�
2479 żeniu."
2480
2481 #: admin/classes/class-wpvr-meta-field.php:820
2482 #: production/admin/classes/class-wpvr-meta-field.php:820
2483 msgid "Zoom Out"
2484 msgstr "pomniejszyć"
2485