| 1 |
msgid "" |
| 2 |
msgstr "" |
| 3 |
"Project-Id-Version: WP VR\n" |
| 4 |
"Report-Msgid-Bugs-To: https://wordpress.org/support/plugin/wpvr\n" |
| 5 |
"POT-Creation-Date: 2026-08-20T04:39:59+00:00\n" |
| 6 |
"PO-Revision-Date: 2025-08-20 07:18+0000\n" |
| 7 |
"Last-Translator: \n" |
| 8 |
"Language-Team: Polish\n" |
| 9 |
"Language: pl_PL\n" |
| 10 |
"MIME-Version: 1.0\n" |
| 11 |
"Content-Type: text/plain; charset=UTF-8\n" |
| 12 |
"Content-Transfer-Encoding: 8bit\n" |
| 13 |
"Plural-Forms: nplurals=3; plural=(n==1 ? 0 : n%10 >= 2 && n%10<=4 &&(n" |
| 14 |
"%100<10||n%100 >= 20)? 1 : 2);\n" |
| 15 |
"X-Generator: Loco https://localise.biz/\n" |
| 16 |
"X-Loco-Version: 2.8.0; wp-6.8.2; php-8.3.8\n" |
| 17 |
|
| 18 |
#. Plugin Name of the plugin |
| 19 |
#: wpvr.php |
| 20 |
msgid "WP VR - 360 Panorama and Virtual Tour Builder" |
| 21 |
msgstr "" |
| 22 |
|
| 23 |
#. Plugin URI of the plugin |
| 24 |
#: wpvr.php |
| 25 |
msgid "https://rextheme.com/wpvr/" |
| 26 |
msgstr "https://rextheme.com/wpvr/" |
| 27 |
|
| 28 |
#. Description of the plugin |
| 29 |
#: wpvr.php |
| 30 |
#, fuzzy |
| 31 |
msgid "" |
| 32 |
"WP VR - 360 Panorama and virtual tour creator is a customized panaroma & " |
| 33 |
"virtual builder tool for your website." |
| 34 |
msgstr "" |
| 35 |
"WP VR - 360 Panorama i Virtual Tour Creator dla WordPress to dostosowane " |
| 36 |
"narzędzie Panaroma & Virtual Builder dla witryny WordPress." |
| 37 |
|
| 38 |
#. Author of the plugin |
| 39 |
#: wpvr.php |
| 40 |
msgid "Rextheme" |
| 41 |
msgstr "rekstemet" |
| 42 |
|
| 43 |
#. Author URI of the plugin |
| 44 |
#: wpvr.php |
| 45 |
msgid "http://rextheme.com/" |
| 46 |
msgstr "http://rextheme.com/" |
| 47 |
|
| 48 |
#: legacy/admin/class-wpvr-admin.php:245 |
| 49 |
msgid "Write your css here" |
| 50 |
msgstr "Napisz tutaj swój CSS tutaj" |
| 51 |
|
| 52 |
#: legacy/admin/class-wpvr-admin.php:246 |
| 53 |
msgid "" |
| 54 |
"Turning On The Video Option Will Erase Your Virtual Tour Data. Are You Sure?" |
| 55 |
msgstr "" |
| 56 |
"Wł� |
| 57 |
czenie opcji wideo usunie Twoje dane z wirtualnej wycieczki. Czy na pewno?" |
| 58 |
|
| 59 |
#: legacy/admin/class-wpvr-admin.php:247 |
| 60 |
msgid "" |
| 61 |
"Turning On The StreetView Option Will Erase Your Virtual Tour Data. Are You " |
| 62 |
"Sure?" |
| 63 |
msgstr "" |
| 64 |
"Wł� |
| 65 |
czenie opcji StreetView spowoduje usunięcie danych z wirtualnej " |
| 66 |
"wycieczki. Czy na pewno?" |
| 67 |
|
| 68 |
#: legacy/admin/class-wpvr-admin.php:248 |
| 69 |
msgid "Adding Hotspots on Scene" |
| 70 |
msgstr "Dodawanie hotspotów na scenie" |
| 71 |
|
| 72 |
#: legacy/admin/class-wpvr-admin.php:269 |
| 73 |
msgid "Successfully Updated" |
| 74 |
msgstr "" |
| 75 |
|
| 76 |
#: legacy/admin/class-wpvr-admin.php:270 |
| 77 |
#, fuzzy |
| 78 |
msgid "Importing..." |
| 79 |
msgstr "znaczyć" |
| 80 |
|
| 81 |
#: legacy/admin/class-wpvr-admin.php:271 |
| 82 |
#, fuzzy |
| 83 |
msgid "Import Now" |
| 84 |
msgstr "znaczyć" |
| 85 |
|
| 86 |
#: legacy/admin/class-wpvr-admin.php:275 |
| 87 |
msgid "Published" |
| 88 |
msgstr "" |
| 89 |
|
| 90 |
#: legacy/admin/class-wpvr-admin.php:279 legacy/includes/setup-wizard.php:100 |
| 91 |
#: src/Admin/Admin.php:211 app/components/modals/ImageResizeWarningModal.jsx:78 |
| 92 |
msgid "Keep this panorama in High Resolution" |
| 93 |
msgstr "" |
| 94 |
|
| 95 |
#: legacy/admin/class-wpvr-admin.php:280 legacy/includes/setup-wizard.php:101 |
| 96 |
#: src/Admin/Admin.php:212 app/components/modals/ImageResizeWarningModal.jsx:94 |
| 97 |
msgid "" |
| 98 |
"By default, a resized version is created while the original image is still " |
| 99 |
"available." |
| 100 |
msgstr "" |
| 101 |
|
| 102 |
#: legacy/admin/class-wpvr-admin.php:281 legacy/includes/setup-wizard.php:102 |
| 103 |
#: src/Admin/Admin.php:213 |
| 104 |
#: app/components/modals/ImageResizeWarningModal.jsx:101 |
| 105 |
#, fuzzy |
| 106 |
msgid "Disable WordPress Large Image Handler on WP VR for future uploads" |
| 107 |
msgstr "Wył� |
| 108 |
cz duży program obsługi obrazów WordPress na WP VR:" |
| 109 |
|
| 110 |
#: legacy/admin/class-wpvr-admin.php:282 legacy/includes/setup-wizard.php:103 |
| 111 |
#: src/Admin/Admin.php:214 |
| 112 |
#: app/components/modals/ImageResizeWarningModal.jsx:103 |
| 113 |
msgid "*Note: Turn this on to use the high-resolution image." |
| 114 |
msgstr "" |
| 115 |
|
| 116 |
#: legacy/admin/class-wpvr-admin.php:283 legacy/includes/setup-wizard.php:104 |
| 117 |
#: src/Admin/Admin.php:215 src/Admin/Admin.php:490 |
| 118 |
#: app/components/modals/CreateSceneModal.jsx:476 |
| 119 |
#: app/components/modals/ImageResizeWarningModal.jsx:86 |
| 120 |
msgid "Close" |
| 121 |
msgstr "" |
| 122 |
|
| 123 |
#: legacy/admin/class-wpvr-admin.php:318 |
| 124 |
msgid "Please upload a scene before proceeding to set hotspot!" |
| 125 |
msgstr "" |
| 126 |
|
| 127 |
#: legacy/admin/class-wpvr-admin.php:319 |
| 128 |
msgid "Negative numbers are not allowed!" |
| 129 |
msgstr "" |
| 130 |
|
| 131 |
#: legacy/admin/class-wpvr-admin.php:348 |
| 132 |
msgid "Setup" |
| 133 |
msgstr "budowa ciała" |
| 134 |
|
| 135 |
#: legacy/admin/class-wpvr-admin.php:350 |
| 136 |
msgid "Tour Preview" |
| 137 |
msgstr "Podgl� |
| 138 |
d wycieczki" |
| 139 |
|
| 140 |
#: legacy/admin/class-wpvr-admin.php:352 |
| 141 |
msgid "Checklist" |
| 142 |
msgstr "" |
| 143 |
|
| 144 |
#: legacy/admin/class-wpvr-admin.php:369 |
| 145 |
#: legacy/admin/classes/class-wpvr-admin-pages.php:70 |
| 146 |
msgid "Get Started" |
| 147 |
msgstr "rozpocz� |
| 148 |
ć" |
| 149 |
|
| 150 |
#: legacy/admin/class-wpvr-admin.php:374 |
| 151 |
msgid "Documentation" |
| 152 |
msgstr "dokumentacja" |
| 153 |
|
| 154 |
#: legacy/admin/class-wpvr-admin.php:381 |
| 155 |
#: legacy/admin/classes/class-wpvr-admin-pages.php:104 |
| 156 |
msgid "Go Pro" |
| 157 |
msgstr "zostać pro" |
| 158 |
|
| 159 |
#: legacy/admin/class-wpvr-admin.php:695 |
| 160 |
#, fuzzy |
| 161 |
msgid "Import Tour" |
| 162 |
msgstr "znaczyć" |
| 163 |
|
| 164 |
#: legacy/admin/class-wpvr-rollback.php:160 |
| 165 |
msgid "WP VR Plugin Rollback" |
| 166 |
msgstr "Wtyczka WP VR Wycofanie wtyczki" |
| 167 |
|
| 168 |
#: legacy/admin/classes/class-setup-meta-box.php:208 |
| 169 |
#: legacy/admin/classes/class-wpvr-meta-field.php:119 |
| 170 |
msgid "Video" |
| 171 |
msgstr "wideo" |
| 172 |
|
| 173 |
#: legacy/admin/classes/class-tour-guide-translation.php:8 |
| 174 |
msgid "Next" |
| 175 |
msgstr "prawie" |
| 176 |
|
| 177 |
#: legacy/admin/classes/class-tour-guide-translation.php:9 |
| 178 |
msgid "Previous" |
| 179 |
msgstr "dawny" |
| 180 |
|
| 181 |
#: legacy/admin/classes/class-tour-guide-translation.php:10 |
| 182 |
msgid "Done" |
| 183 |
msgstr "spełniony" |
| 184 |
|
| 185 |
#: legacy/admin/classes/class-tour-guide-translation.php:11 |
| 186 |
#, fuzzy |
| 187 |
msgid "Skip Tour" |
| 188 |
msgstr "wycieczka z przewodnikiem" |
| 189 |
|
| 190 |
#: legacy/admin/classes/class-tour-preview-meta-box.php:169 |
| 191 |
#: legacy/admin/classes/class-tour-preview-meta-box.php:196 |
| 192 |
#: legacy/admin/classes/class-tour-preview-meta-box.php:645 |
| 193 |
msgid "Add This Position Into Active Hotspot" |
| 194 |
msgstr "" |
| 195 |
|
| 196 |
#: legacy/admin/classes/class-tour-preview-meta-box.php:569 |
| 197 |
msgid "PRO PREVIEW" |
| 198 |
msgstr "" |
| 199 |
|
| 200 |
#: legacy/admin/classes/class-tour-preview-meta-box.php:584 |
| 201 |
#: legacy/admin/classes/class-wpvr-meta-field.php:985 |
| 202 |
msgid "Scene Gallery" |
| 203 |
msgstr "Galeria scen" |
| 204 |
|
| 205 |
#: legacy/admin/classes/class-tour-preview-meta-box.php:593 |
| 206 |
#, fuzzy |
| 207 |
msgid "Scene 1" |
| 208 |
msgstr "Identyfikator scen" |
| 209 |
|
| 210 |
#: legacy/admin/classes/class-tour-preview-meta-box.php:594 |
| 211 |
#, fuzzy |
| 212 |
msgid "Scene 2" |
| 213 |
msgstr "Identyfikator scen" |
| 214 |
|
| 215 |
#: legacy/admin/classes/class-tour-preview-meta-box.php:595 |
| 216 |
#, fuzzy |
| 217 |
msgid "Scene 3" |
| 218 |
msgstr "Identyfikator scen" |
| 219 |
|
| 220 |
#: legacy/admin/classes/class-tour-preview-meta-box.php:601 |
| 221 |
#, fuzzy |
| 222 |
msgid "Background Music" |
| 223 |
msgstr "Muzyka w tle wycieczki" |
| 224 |
|
| 225 |
#: legacy/admin/classes/class-tour-preview-meta-box.php:606 |
| 226 |
#, fuzzy |
| 227 |
msgid "Gyroscope — Active on mobile" |
| 228 |
msgstr "Powiadomienia o żyroskopie i urz� |
| 229 |
dzeniach mobilnych" |
| 230 |
|
| 231 |
#: legacy/admin/classes/class-tour-preview-meta-box.php:944 |
| 232 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3307 |
| 233 |
msgid "Preview" |
| 234 |
msgstr "prapremiera" |
| 235 |
|
| 236 |
#: legacy/admin/classes/class-wpvr-admin-pages.php:73 |
| 237 |
#: legacy/admin/classes/class-wpvr-post-type.php:363 |
| 238 |
#: legacy/admin/classes/class-wpvr-post-type.php:364 |
| 239 |
msgid "Tours" |
| 240 |
msgstr "wycieczki" |
| 241 |
|
| 242 |
#: legacy/admin/classes/class-wpvr-admin-pages.php:75 |
| 243 |
#: legacy/admin/classes/class-wpvr-post-type.php:365 |
| 244 |
#: legacy/admin/classes/class-wpvr-post-type.php:366 src/Admin/Admin.php:58 |
| 245 |
#: src/Admin/Admin.php:234 src/Admin/Admin.php:357 |
| 246 |
msgid "Add New Tour" |
| 247 |
msgstr "Dodaj now� |
| 248 |
wycieczkę" |
| 249 |
|
| 250 |
#: legacy/admin/classes/class-wpvr-admin-pages.php:87 |
| 251 |
#: legacy/admin/classes/class-wpvr-meta-field.php:110 |
| 252 |
msgid "Settings" |
| 253 |
msgstr "Ustawienie" |
| 254 |
|
| 255 |
#: legacy/admin/classes/class-wpvr-admin-pages.php:92 |
| 256 |
#: legacy/admin/partials/wpvr_documentation.php:22 |
| 257 |
msgid "Free vs Pro" |
| 258 |
msgstr "darmowe vs pro" |
| 259 |
|
| 260 |
#: legacy/admin/classes/class-wpvr-admin-pages.php:95 |
| 261 |
msgid "Setup Wizard" |
| 262 |
msgstr "" |
| 263 |
|
| 264 |
#: legacy/admin/classes/class-wpvr-ajax.php:691 |
| 265 |
#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:635 |
| 266 |
msgid "Permission check failed" |
| 267 |
msgstr "Sprawdzanie uprawnień nie powi" |
| 268 |
|
| 269 |
#: legacy/admin/classes/class-wpvr-ajax.php:728 |
| 270 |
msgid "Email is required" |
| 271 |
msgstr "" |
| 272 |
|
| 273 |
#: legacy/admin/classes/class-wpvr-ajax.php:730 |
| 274 |
msgid "Email is invalid" |
| 275 |
msgstr "" |
| 276 |
|
| 277 |
#: legacy/admin/classes/class-wpvr-ajax.php:740 |
| 278 |
msgid "Contact created successfully" |
| 279 |
msgstr "" |
| 280 |
|
| 281 |
#: legacy/admin/classes/class-wpvr-ajax.php:742 |
| 282 |
msgid "Failed to create contact" |
| 283 |
msgstr "" |
| 284 |
|
| 285 |
#: legacy/admin/classes/class-wpvr-ajax.php:776 |
| 286 |
msgid "General setting data successfully saved." |
| 287 |
msgstr "" |
| 288 |
|
| 289 |
#: legacy/admin/classes/class-wpvr-ajax.php:821 |
| 290 |
msgid "Opt-in value saved." |
| 291 |
msgstr "" |
| 292 |
|
| 293 |
#. translators: %s: url to publish first tour |
| 294 |
#: legacy/admin/classes/class-wpvr-first-tour-banner.php:112 |
| 295 |
#, php-format |
| 296 |
msgid "" |
| 297 |
"You haven't published your first tour yet. <a href=\"%s\">Publish your first " |
| 298 |
"tour</a> and see it live in minutes!" |
| 299 |
msgstr "" |
| 300 |
|
| 301 |
#. translators: %s: url to upgrade to pro |
| 302 |
#: legacy/admin/classes/class-wpvr-first-tour-banner.php:127 |
| 303 |
#, php-format |
| 304 |
msgid "" |
| 305 |
"You've published your first tour! <a href=\"%s\" target=\"_blank\" rel=" |
| 306 |
"\"noopener\">Upgrade to Pro</a> for unlimited tours, hotspots, and advanced " |
| 307 |
"features!" |
| 308 |
msgstr "" |
| 309 |
|
| 310 |
#: legacy/admin/classes/class-wpvr-general.php:78 |
| 311 |
#: legacy/admin/classes/class-wpvr-shortcode.php:32 |
| 312 |
msgid "Using this Tour" |
| 313 |
msgstr "Korzystanie z tej wycieczki" |
| 314 |
|
| 315 |
#: legacy/admin/classes/class-wpvr-general.php:84 |
| 316 |
msgid "To Embed on External Page:" |
| 317 |
msgstr "Aby osadzić na zewnętrznej stronie:" |
| 318 |
|
| 319 |
#: legacy/admin/classes/class-wpvr-general.php:88 |
| 320 |
msgid "Use the iframe below to share this tour on an external page." |
| 321 |
msgstr "" |
| 322 |
"Użyj poniższej iframe, aby udostępnić tę wycieczkę na zewnętrznej stronie." |
| 323 |
|
| 324 |
#: legacy/admin/classes/class-wpvr-general.php:90 |
| 325 |
msgid "" |
| 326 |
"Note: WooCommerce & Fluent Forms hotspots will not be supported on " |
| 327 |
"embedded tours." |
| 328 |
msgstr "" |
| 329 |
"Uwaga: Hotspoty WooCommerce & Amp; Fluent Forms Hotspoty nie będ� |
| 330 |
" |
| 331 |
"obsługiwane podczas wycieczek osadzonych." |
| 332 |
|
| 333 |
#: legacy/admin/classes/class-wpvr-general.php:105 |
| 334 |
msgid "Share your tour" |
| 335 |
msgstr "Udostępnij swoj� |
| 336 |
wycieczkę" |
| 337 |
|
| 338 |
#: legacy/admin/classes/class-wpvr-general.php:110 |
| 339 |
msgid "Enable Social Media Share" |
| 340 |
msgstr "Wł� |
| 341 |
cz udostępnianie w mediach społecznościowych" |
| 342 |
|
| 343 |
#: legacy/admin/classes/class-wpvr-general.php:127 |
| 344 |
msgid "Create a tour use this QR code" |
| 345 |
msgstr "Utwórz wycieczkę Użyj tego kodu QR" |
| 346 |
|
| 347 |
#: legacy/admin/classes/class-wpvr-general.php:132 |
| 348 |
msgid "Download QR Code" |
| 349 |
msgstr "pobierz kod QR" |
| 350 |
|
| 351 |
#: legacy/admin/classes/class-wpvr-hotspot.php:109 |
| 352 |
#: legacy/admin/classes/class-wpvr-hotspot.php:169 |
| 353 |
#, fuzzy |
| 354 |
msgid "Hotspot Settings" |
| 355 |
msgstr "Ustawienie hotspotu" |
| 356 |
|
| 357 |
#: legacy/admin/classes/class-wpvr-meta-field.php:92 |
| 358 |
msgid "Scenes" |
| 359 |
msgstr "scenki" |
| 360 |
|
| 361 |
#: legacy/admin/classes/class-wpvr-meta-field.php:101 |
| 362 |
msgid "Hotspot" |
| 363 |
msgstr "gor� |
| 364 |
cy miejsce" |
| 365 |
|
| 366 |
#: legacy/admin/classes/class-wpvr-meta-field.php:135 |
| 367 |
#: legacy/admin/classes/class-wpvr-meta-field.php:830 |
| 368 |
msgid "Floor Plan" |
| 369 |
msgstr "" |
| 370 |
|
| 371 |
#: legacy/admin/classes/class-wpvr-meta-field.php:147 |
| 372 |
#: legacy/admin/classes/class-wpvr-meta-field.php:839 |
| 373 |
#: legacy/admin/classes/class-wpvr-post-type.php:160 |
| 374 |
#, fuzzy |
| 375 |
msgid "Background Tour" |
| 376 |
msgstr "Kolor tła" |
| 377 |
|
| 378 |
#: legacy/admin/classes/class-wpvr-meta-field.php:159 |
| 379 |
#: legacy/admin/classes/class-wpvr-meta-field.php:848 |
| 380 |
#: legacy/admin/classes/class-wpvr-post-type.php:143 src/Admin/Admin.php:556 |
| 381 |
#, fuzzy |
| 382 |
msgid "Street View" |
| 383 |
msgstr "Widok ulicy Google" |
| 384 |
|
| 385 |
#: legacy/admin/classes/class-wpvr-meta-field.php:212 |
| 386 |
msgid "Set a Tour Preview Image" |
| 387 |
msgstr "Ustaw obraz podgl� |
| 388 |
du wycieczki" |
| 389 |
|
| 390 |
#: legacy/admin/classes/class-wpvr-meta-field.php:215 |
| 391 |
msgid "" |
| 392 |
"Upload an image that will be shown as the preview before the tour starts." |
| 393 |
msgstr "" |
| 394 |
|
| 395 |
#: legacy/admin/classes/class-wpvr-meta-field.php:224 |
| 396 |
msgid "Preview Image Message" |
| 397 |
msgstr "Wyświetl wiadomość obrazkow� |
| 398 |
" |
| 399 |
|
| 400 |
#: legacy/admin/classes/class-wpvr-meta-field.php:226 |
| 401 |
msgid "Add a custom message that appears alongside the tour preview image." |
| 402 |
msgstr "" |
| 403 |
|
| 404 |
#: legacy/admin/classes/class-wpvr-meta-field.php:234 |
| 405 |
msgid "Tour Autoload" |
| 406 |
msgstr "Automatyczne ładowanie wycieczki" |
| 407 |
|
| 408 |
#: legacy/admin/classes/class-wpvr-meta-field.php:238 |
| 409 |
msgid "" |
| 410 |
"Automatically start the tour when the page is loaded without displaying the " |
| 411 |
"preview image." |
| 412 |
msgstr "" |
| 413 |
|
| 414 |
#: legacy/admin/classes/class-wpvr-meta-field.php:286 |
| 415 |
msgid "Basic Control Buttons" |
| 416 |
msgstr "Podstawowe przyciski sterowania" |
| 417 |
|
| 418 |
#: legacy/admin/classes/class-wpvr-meta-field.php:290 |
| 419 |
msgid "" |
| 420 |
"Enable basic navigation buttons like play, pause, and reset for easier " |
| 421 |
"control of the tour." |
| 422 |
msgstr "" |
| 423 |
|
| 424 |
#: legacy/admin/classes/class-wpvr-meta-field.php:297 |
| 425 |
msgid "Scene Fade Duration" |
| 426 |
msgstr "Czas trwania zanikania sceny" |
| 427 |
|
| 428 |
#: legacy/admin/classes/class-wpvr-meta-field.php:303 |
| 429 |
msgid "Set the duration (in milliseconds) for the fade effect between scenes." |
| 430 |
msgstr "" |
| 431 |
|
| 432 |
#: legacy/admin/classes/class-wpvr-meta-field.php:309 |
| 433 |
msgid "Auto Rotation" |
| 434 |
msgstr "Obrót automatyczny" |
| 435 |
|
| 436 |
#: legacy/admin/classes/class-wpvr-meta-field.php:315 |
| 437 |
msgid "" |
| 438 |
"Enable automatic rotation of the tour for continuous movement without user " |
| 439 |
"interaction." |
| 440 |
msgstr "" |
| 441 |
|
| 442 |
#: legacy/admin/classes/class-wpvr-meta-field.php:328 |
| 443 |
#, fuzzy |
| 444 |
msgid "Control Access" |
| 445 |
msgstr "Przyciski steruj� |
| 446 |
ce" |
| 447 |
|
| 448 |
#: legacy/admin/classes/class-wpvr-meta-field.php:336 |
| 449 |
msgid "Restrict this tour to selected membership levels." |
| 450 |
msgstr "" |
| 451 |
|
| 452 |
#: legacy/admin/classes/class-wpvr-meta-field.php:368 |
| 453 |
msgid "Generic Form" |
| 454 |
msgstr "Formularz ogólny" |
| 455 |
|
| 456 |
#: legacy/admin/classes/class-wpvr-meta-field.php:375 |
| 457 |
msgid "Enable this to add a form to the tour for user interaction." |
| 458 |
msgstr "" |
| 459 |
|
| 460 |
#: legacy/admin/classes/class-wpvr-meta-field.php:404 |
| 461 |
msgid "Call To Action " |
| 462 |
msgstr "wezwanie" |
| 463 |
|
| 464 |
#: legacy/admin/classes/class-wpvr-meta-field.php:411 |
| 465 |
msgid "" |
| 466 |
"Add a call-to-action button that prompts users to take action during the " |
| 467 |
"tour." |
| 468 |
msgstr "" |
| 469 |
|
| 470 |
#: legacy/admin/classes/class-wpvr-meta-field.php:441 |
| 471 |
msgid "Custom CSS " |
| 472 |
msgstr "Niestandardowe CSS" |
| 473 |
|
| 474 |
#: legacy/admin/classes/class-wpvr-meta-field.php:448 |
| 475 |
msgid "" |
| 476 |
"Add your own custom CSS styles to further personalize the look and feel of " |
| 477 |
"the tour." |
| 478 |
msgstr "" |
| 479 |
|
| 480 |
#: legacy/admin/classes/class-wpvr-meta-field.php:538 |
| 481 |
msgid "Rotation Speed and Direction" |
| 482 |
msgstr "Prędkość obrotowa i kierunek" |
| 483 |
|
| 484 |
#: legacy/admin/classes/class-wpvr-meta-field.php:544 |
| 485 |
msgid "" |
| 486 |
"Set the rotation speed, with positive values for anti-clockwise rotation and " |
| 487 |
"negative values for clockwise rotation." |
| 488 |
msgstr "" |
| 489 |
|
| 490 |
#: legacy/admin/classes/class-wpvr-meta-field.php:550 |
| 491 |
msgid "Resume Auto-rotation after" |
| 492 |
msgstr "Wznów automatyczne obracanie po" |
| 493 |
|
| 494 |
#: legacy/admin/classes/class-wpvr-meta-field.php:556 |
| 495 |
msgid "" |
| 496 |
"Define the time (in milliseconds) after which auto-rotation will resume once " |
| 497 |
"the user clicks on the tour." |
| 498 |
msgstr "" |
| 499 |
|
| 500 |
#: legacy/admin/classes/class-wpvr-meta-field.php:562 |
| 501 |
msgid "Stop Auto-rotation after" |
| 502 |
msgstr "Zatrzymaj automatyczne obracanie po" |
| 503 |
|
| 504 |
#: legacy/admin/classes/class-wpvr-meta-field.php:568 |
| 505 |
msgid "" |
| 506 |
"Set the time (in milliseconds) after which the auto-rotation will stop " |
| 507 |
"automatically." |
| 508 |
msgstr "" |
| 509 |
|
| 510 |
#: legacy/admin/classes/class-wpvr-meta-field.php:590 |
| 511 |
msgid "Select Transition Style" |
| 512 |
msgstr "" |
| 513 |
|
| 514 |
#: legacy/admin/classes/class-wpvr-meta-field.php:598 |
| 515 |
msgid "This will set the scene fade effect and execution time." |
| 516 |
msgstr "Spowoduje to ustawienie efektu zanikania sceny i czasu wykonania." |
| 517 |
|
| 518 |
#: legacy/admin/classes/class-wpvr-meta-field.php:604 |
| 519 |
#, fuzzy |
| 520 |
msgid "Scene Transition Duration (ms)" |
| 521 |
msgstr "Czas trwania zanikania sceny" |
| 522 |
|
| 523 |
#: legacy/admin/classes/class-wpvr-meta-field.php:612 |
| 524 |
msgid "" |
| 525 |
"Set the duration for scene transition animations in milliseconds (default: " |
| 526 |
"500 ms)." |
| 527 |
msgstr "" |
| 528 |
|
| 529 |
#: legacy/admin/classes/class-wpvr-meta-field.php:619 |
| 530 |
msgid "Add Animation Delay (ms)" |
| 531 |
msgstr "" |
| 532 |
|
| 533 |
#: legacy/admin/classes/class-wpvr-meta-field.php:628 |
| 534 |
msgid "" |
| 535 |
"Set the delay before the scene transition animation starts (default: 0 ms)." |
| 536 |
msgstr "" |
| 537 |
|
| 538 |
#: legacy/admin/classes/class-wpvr-meta-field.php:640 |
| 539 |
msgid "Add Form Shortcode" |
| 540 |
msgstr "Dodaj krótki kod formularza" |
| 541 |
|
| 542 |
#: legacy/admin/classes/class-wpvr-meta-field.php:646 |
| 543 |
#, fuzzy |
| 544 |
msgid "Insert the shortcode for the form you want to display in the tour." |
| 545 |
msgstr "Wydrukuj formularze Shortcode, które chcesz wyświetlić." |
| 546 |
|
| 547 |
#: legacy/admin/classes/class-wpvr-meta-field.php:659 |
| 548 |
msgid "Button Text" |
| 549 |
msgstr "Tekst przycisku" |
| 550 |
|
| 551 |
#: legacy/admin/classes/class-wpvr-meta-field.php:665 |
| 552 |
msgid "Customize the text displayed on the call-to-action button." |
| 553 |
msgstr "" |
| 554 |
|
| 555 |
#: legacy/admin/classes/class-wpvr-meta-field.php:671 |
| 556 |
msgid "Button URL" |
| 557 |
msgstr "Adres URL przycisku" |
| 558 |
|
| 559 |
#: legacy/admin/classes/class-wpvr-meta-field.php:677 |
| 560 |
msgid "" |
| 561 |
"Set the link the call-to-action button will direct users to when clicked." |
| 562 |
msgstr "" |
| 563 |
|
| 564 |
#: legacy/admin/classes/class-wpvr-meta-field.php:683 |
| 565 |
msgid "Button Style" |
| 566 |
msgstr "Styl przycisku" |
| 567 |
|
| 568 |
#: legacy/admin/classes/class-wpvr-meta-field.php:689 |
| 569 |
msgid "Print the forms shortcode you want to show." |
| 570 |
msgstr "Wydrukuj formularze Shortcode, które chcesz wyświetlić." |
| 571 |
|
| 572 |
#: legacy/admin/classes/class-wpvr-meta-field.php:700 |
| 573 |
msgid "Custom CSS" |
| 574 |
msgstr "Niestandardowe CSS" |
| 575 |
|
| 576 |
#: legacy/admin/classes/class-wpvr-meta-field.php:826 |
| 577 |
#: legacy/admin/classes/class-wpvr-meta-field.php:835 |
| 578 |
#: legacy/admin/classes/class-wpvr-meta-field.php:844 |
| 579 |
#: legacy/admin/classes/class-wpvr-meta-field.php:853 |
| 580 |
#: legacy/admin/classes/class-wpvr-post-type.php:147 |
| 581 |
#: legacy/admin/classes/class-wpvr-post-type.php:164 |
| 582 |
#: legacy/admin/partials/wpvr_documentation.php:95 |
| 583 |
msgid "pro" |
| 584 |
msgstr "zawodowiec" |
| 585 |
|
| 586 |
#: legacy/admin/classes/class-wpvr-meta-field.php:857 |
| 587 |
#: legacy/admin/classes/class-wpvr-meta-field.php:870 |
| 588 |
msgid "Export" |
| 589 |
msgstr "eksportowy" |
| 590 |
|
| 591 |
#: legacy/admin/classes/class-wpvr-meta-field.php:894 |
| 592 |
msgid "Keyboard Movement Control" |
| 593 |
msgstr "Kontrola ruchu klawiatury" |
| 594 |
|
| 595 |
#: legacy/admin/classes/class-wpvr-meta-field.php:898 |
| 596 |
msgid "Use arrow keys or WASD keys to move through the virtual tour." |
| 597 |
msgstr "" |
| 598 |
|
| 599 |
#: legacy/admin/classes/class-wpvr-meta-field.php:905 |
| 600 |
msgid "Keyboard Zoom Control" |
| 601 |
msgstr "Kontrola zoomu klawiatury" |
| 602 |
|
| 603 |
#: legacy/admin/classes/class-wpvr-meta-field.php:909 |
| 604 |
msgid "Zoom in and out of the virtual tour using keyboard shortcuts." |
| 605 |
msgstr "" |
| 606 |
|
| 607 |
#: legacy/admin/classes/class-wpvr-meta-field.php:916 |
| 608 |
msgid "Mouse Drag Control" |
| 609 |
msgstr "Kontrola przeci� |
| 610 |
gania myszy" |
| 611 |
|
| 612 |
#: legacy/admin/classes/class-wpvr-meta-field.php:920 |
| 613 |
msgid "" |
| 614 |
"Click and drag with your mouse to look around and navigate the virtual tour." |
| 615 |
msgstr "" |
| 616 |
|
| 617 |
#: legacy/admin/classes/class-wpvr-meta-field.php:927 |
| 618 |
msgid "Mouse Zoom Control" |
| 619 |
msgstr "Kontrola zoomu myszy" |
| 620 |
|
| 621 |
#: legacy/admin/classes/class-wpvr-meta-field.php:931 |
| 622 |
msgid "" |
| 623 |
"Use your mouse wheel to zoom in and out smoothly within the virtual tour." |
| 624 |
msgstr "" |
| 625 |
|
| 626 |
#: legacy/admin/classes/class-wpvr-meta-field.php:938 |
| 627 |
msgid "Gyroscope Control" |
| 628 |
msgstr "Sterowanie żyroskopem" |
| 629 |
|
| 630 |
#: legacy/admin/classes/class-wpvr-meta-field.php:942 |
| 631 |
msgid "" |
| 632 |
"Move your mobile device to explore the tour using built-in motion sensors." |
| 633 |
msgstr "" |
| 634 |
|
| 635 |
#: legacy/admin/classes/class-wpvr-meta-field.php:949 |
| 636 |
msgid "Auto Gyroscope Support" |
| 637 |
msgstr "Obsługa żyroskopu samochodowego" |
| 638 |
|
| 639 |
#: legacy/admin/classes/class-wpvr-meta-field.php:953 |
| 640 |
msgid "" |
| 641 |
"Automatically activate device orientation control if enabled, or manually " |
| 642 |
"trigger it with a button." |
| 643 |
msgstr "" |
| 644 |
|
| 645 |
#: legacy/admin/classes/class-wpvr-meta-field.php:960 |
| 646 |
msgid "Compass" |
| 647 |
msgstr "opasanie" |
| 648 |
|
| 649 |
#: legacy/admin/classes/class-wpvr-meta-field.php:964 |
| 650 |
msgid "" |
| 651 |
"Display a directional guide to keep track of your orientation while " |
| 652 |
"navigating the virtual tour." |
| 653 |
msgstr "" |
| 654 |
|
| 655 |
#: legacy/admin/classes/class-wpvr-meta-field.php:990 |
| 656 |
msgid "" |
| 657 |
"Show a gallery of all scenes, allowing users to easily navigate by clicking " |
| 658 |
"on thumbnails." |
| 659 |
msgstr "" |
| 660 |
|
| 661 |
#: legacy/admin/classes/class-wpvr-meta-field.php:996 |
| 662 |
msgid "Scene Titles on Gallery" |
| 663 |
msgstr "Tytuły scen w galerii" |
| 664 |
|
| 665 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1001 |
| 666 |
#, fuzzy |
| 667 |
msgid "" |
| 668 |
"Display scene titles on each thumbnail in the Scene Gallery for better " |
| 669 |
"identification." |
| 670 |
msgstr "" |
| 671 |
"Wł� |
| 672 |
czenie go spowoduje wyświetlenie tytułów scen na każdej miniaturze sceny " |
| 673 |
"w galerii sceny. Identyfikatory scen będ� |
| 674 |
używane jako tytuł sceny." |
| 675 |
|
| 676 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1007 |
| 677 |
msgid "Scene Navigation Menu" |
| 678 |
msgstr "Menu nawigacji sceny" |
| 679 |
|
| 680 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1012 |
| 681 |
msgid "" |
| 682 |
"Enable a menu to navigate through all scenes, allowing users to jump to a " |
| 683 |
"specific scene." |
| 684 |
msgstr "" |
| 685 |
|
| 686 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1018 |
| 687 |
msgid "Tour Background Music" |
| 688 |
msgstr "Muzyka w tle wycieczki" |
| 689 |
|
| 690 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1023 |
| 691 |
msgid "Add background music to your tour to enhance the user experience." |
| 692 |
msgstr "" |
| 693 |
|
| 694 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1029 |
| 695 |
msgid "Enable explainer video" |
| 696 |
msgstr "Wł� |
| 697 |
cz wideo wyjaśniaj� |
| 698 |
ce" |
| 699 |
|
| 700 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1033 |
| 701 |
msgid "" |
| 702 |
"Add an explainer video to the tour, providing additional context or details " |
| 703 |
"for users." |
| 704 |
msgstr "" |
| 705 |
|
| 706 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1040 |
| 707 |
msgid "Set Zoom Preferences" |
| 708 |
msgstr "Ustaw preferencje powiększenia" |
| 709 |
|
| 710 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1044 |
| 711 |
msgid "" |
| 712 |
"Customize the zoom level for your tour, with options to adjust the view " |
| 713 |
"between 50 to 120 degrees." |
| 714 |
msgstr "" |
| 715 |
|
| 716 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1051 |
| 717 |
msgid "Add Company Information" |
| 718 |
msgstr "Dodaj informacje o firmie" |
| 719 |
|
| 720 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1056 |
| 721 |
msgid "" |
| 722 |
"Include your company logo and details within the tour to brand the " |
| 723 |
"experience." |
| 724 |
msgstr "" |
| 725 |
|
| 726 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1078 |
| 727 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1148 |
| 728 |
msgid "Scene Type" |
| 729 |
msgstr "Typ sceny" |
| 730 |
|
| 731 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1085 |
| 732 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1155 |
| 733 |
msgid "Choose the type of scene, such as Equirectangular or Cubemap." |
| 734 |
msgstr "" |
| 735 |
|
| 736 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1091 |
| 737 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1160 |
| 738 |
msgid "Scene Upload" |
| 739 |
msgstr "Przesyłanie sceny" |
| 740 |
|
| 741 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1097 |
| 742 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1166 |
| 743 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2275 |
| 744 |
msgid "Upload an image to be used as the scene media (video is not supported)." |
| 745 |
msgstr "" |
| 746 |
|
| 747 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1103 |
| 748 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1172 |
| 749 |
msgid "Set as Default" |
| 750 |
msgstr "Ustaw jako domyślny" |
| 751 |
|
| 752 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1109 |
| 753 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1178 |
| 754 |
msgid "Make this scene the first one that appears when the tour loads." |
| 755 |
msgstr "" |
| 756 |
|
| 757 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1115 |
| 758 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1184 |
| 759 |
msgid "Scene ID" |
| 760 |
msgstr "Identyfikator scen" |
| 761 |
|
| 762 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1122 |
| 763 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1191 |
| 764 |
msgid "Unique identifier for the scene, auto-generated if left empty." |
| 765 |
msgstr "" |
| 766 |
|
| 767 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1211 |
| 768 |
msgid "Hotspot ID" |
| 769 |
msgstr "Identyfikator hotspotu" |
| 770 |
|
| 771 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1218 |
| 772 |
msgid "A unique identifier for the hotspot, auto-generated if left empty." |
| 773 |
msgstr "" |
| 774 |
|
| 775 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1224 |
| 776 |
msgid "Pitch" |
| 777 |
msgstr "wystawiać towar" |
| 778 |
|
| 779 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1231 |
| 780 |
msgid "Set the pitch angle for the hotspot’s vertical position in the scene." |
| 781 |
msgstr "" |
| 782 |
|
| 783 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1236 |
| 784 |
msgid "Yaw" |
| 785 |
msgstr "schodzić z kursu" |
| 786 |
|
| 787 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1243 |
| 788 |
msgid "Set the yaw angle for the hotspot’s horizontal position in the scene." |
| 789 |
msgstr "" |
| 790 |
|
| 791 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1248 |
| 792 |
msgid "Hotspot Custom Icon Class" |
| 793 |
msgstr "Niestandardowa klasa ikon Hotspot" |
| 794 |
|
| 795 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1255 |
| 796 |
msgid "Add a custom CSS class for the hotspot icon." |
| 797 |
msgstr "" |
| 798 |
|
| 799 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1274 |
| 800 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1360 |
| 801 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1452 |
| 802 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1518 |
| 803 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1584 |
| 804 |
msgid "Hotspot-Type" |
| 805 |
msgstr "Hotspot-typ" |
| 806 |
|
| 807 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1278 |
| 808 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1364 |
| 809 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1462 |
| 810 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1528 |
| 811 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1588 |
| 812 |
msgid "URL" |
| 813 |
msgstr "URL" |
| 814 |
|
| 815 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1284 |
| 816 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1370 |
| 817 |
msgid "Provide a URL that the hotspot will link to when clicked." |
| 818 |
msgstr "" |
| 819 |
|
| 820 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1289 |
| 821 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1375 |
| 822 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1468 |
| 823 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1534 |
| 824 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1594 |
| 825 |
msgid "Open in same tab" |
| 826 |
msgstr "Otwórz w tej samej karcie" |
| 827 |
|
| 828 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1295 |
| 829 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1381 |
| 830 |
msgid "Choose whether the URL opens in the same tab or a new tab." |
| 831 |
msgstr "" |
| 832 |
|
| 833 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1301 |
| 834 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1387 |
| 835 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1475 |
| 836 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1541 |
| 837 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1601 |
| 838 |
msgid "On Click Content" |
| 839 |
msgstr "Przy kliknięciu treści" |
| 840 |
|
| 841 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1305 |
| 842 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1393 |
| 843 |
msgid "Add custom content or actions that occur when the hotspot is clicked." |
| 844 |
msgstr "" |
| 845 |
|
| 846 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1311 |
| 847 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1399 |
| 848 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1482 |
| 849 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1548 |
| 850 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1607 |
| 851 |
msgid "On Hover Content" |
| 852 |
msgstr "Na najechaniu zawartości" |
| 853 |
|
| 854 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1315 |
| 855 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1405 |
| 856 |
msgid "" |
| 857 |
"Add custom content or actions that appear when the user hovers over the " |
| 858 |
"hotspot." |
| 859 |
msgstr "" |
| 860 |
|
| 861 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1320 |
| 862 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1410 |
| 863 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1488 |
| 864 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1554 |
| 865 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1613 |
| 866 |
msgid "Select Target Scene from List" |
| 867 |
msgstr "Wybierz scenę docelow� |
| 868 |
z listy" |
| 869 |
|
| 870 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1324 |
| 871 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1415 |
| 872 |
msgid "Choose the target scene for the hotspot to navigate to." |
| 873 |
msgstr "" |
| 874 |
|
| 875 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1329 |
| 876 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1420 |
| 877 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1493 |
| 878 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1559 |
| 879 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1618 |
| 880 |
msgid "Target Scene ID" |
| 881 |
msgstr "Identyfikator sceny docelowe" |
| 882 |
|
| 883 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1336 |
| 884 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1427 |
| 885 |
msgid "Provide the unique ID of the target scene." |
| 886 |
msgstr "" |
| 887 |
|
| 888 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1456 |
| 889 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1522 |
| 890 |
msgid "Select your form" |
| 891 |
msgstr "Wybierz swój formularz" |
| 892 |
|
| 893 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1646 |
| 894 |
msgid "Basic Settings" |
| 895 |
msgstr "Podstawowe ustawienia" |
| 896 |
|
| 897 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1655 |
| 898 |
msgid "Advanced Controls" |
| 899 |
msgstr "Zaawansowane sterowanie" |
| 900 |
|
| 901 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1700 |
| 902 |
msgid "Documentation " |
| 903 |
msgstr "dokumentacja" |
| 904 |
|
| 905 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1918 |
| 906 |
#, fuzzy |
| 907 |
msgid "Video Tour" |
| 908 |
msgstr "wycieczka z przewodnikiem" |
| 909 |
|
| 910 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1938 |
| 911 |
msgid "Enable or disable video mode using self-hosted, YouTube, or Vimeo." |
| 912 |
msgstr "" |
| 913 |
|
| 914 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1945 |
| 915 |
msgid "Upload or Add Link" |
| 916 |
msgstr "Prześlij lub dodaj link" |
| 917 |
|
| 918 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1946 |
| 919 |
msgid "Paste Youtube or Vimeo link or upload" |
| 920 |
msgstr "Wklej link do YouTube lub Vimeo lub prześlij" |
| 921 |
|
| 922 |
#: legacy/admin/classes/class-wpvr-meta-field.php:1952 |
| 923 |
msgid "Use a self-hosted file or paste a YouTube/Vimeo link." |
| 924 |
msgstr "" |
| 925 |
|
| 926 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2010 |
| 927 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2062 |
| 928 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2116 |
| 929 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2158 |
| 930 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2207 |
| 931 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2282 |
| 932 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2338 |
| 933 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2397 |
| 934 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2457 |
| 935 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2514 |
| 936 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2571 |
| 937 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2628 |
| 938 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2704 |
| 939 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2856 |
| 940 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2999 |
| 941 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3065 |
| 942 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3119 |
| 943 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3180 |
| 944 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3230 |
| 945 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3284 |
| 946 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3332 |
| 947 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3418 |
| 948 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3470 |
| 949 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3524 |
| 950 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3580 |
| 951 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3630 |
| 952 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3678 |
| 953 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3767 |
| 954 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3819 |
| 955 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3870 |
| 956 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3973 |
| 957 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4025 |
| 958 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4077 |
| 959 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4123 |
| 960 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4181 |
| 961 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4225 |
| 962 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4270 |
| 963 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4315 |
| 964 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4426 |
| 965 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4474 |
| 966 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4571 |
| 967 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4644 |
| 968 |
#: legacy/admin/classes/class-wpvr-meta-field.php:5005 |
| 969 |
#: legacy/admin/classes/class-wpvr-meta-field.php:5057 |
| 970 |
#: legacy/admin/classes/class-wpvr-meta-field.php:5157 |
| 971 |
#: legacy/admin/classes/class-wpvr-meta-field.php:5257 |
| 972 |
#: legacy/admin/classes/class-wpvr-meta-field.php:5374 |
| 973 |
#: legacy/admin/classes/class-wpvr-meta-field.php:5487 |
| 974 |
#: legacy/admin/classes/class-wpvr-meta-field.php:5593 |
| 975 |
#: legacy/admin/classes/class-wpvr-meta-field.php:5705 |
| 976 |
#: legacy/admin/classes/class-wpvr-meta-field.php:5812 |
| 977 |
#: legacy/includes/class-wpvr.php:356 |
| 978 |
msgid "View Doc" |
| 979 |
msgstr "" |
| 980 |
|
| 981 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2021 |
| 982 |
#: legacy/admin/partials/wpvr-review-request-body-content.php:6 |
| 983 |
#: legacy/admin/partials/wpvr_confirmation_alert.php:30 |
| 984 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:173 |
| 985 |
msgid "Yes" |
| 986 |
msgstr "ba" |
| 987 |
|
| 988 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2022 |
| 989 |
#: legacy/admin/partials/wpvr_confirmation_alert.php:27 |
| 990 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:174 |
| 991 |
msgid "No" |
| 992 |
msgstr "bynajm" |
| 993 |
|
| 994 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2073 |
| 995 |
msgid "Equirectangular" |
| 996 |
msgstr "równowartościowy" |
| 997 |
|
| 998 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2074 |
| 999 |
msgid "Cubemap" |
| 1000 |
msgstr "Mapa słowna" |
| 1001 |
|
| 1002 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2270 |
| 1003 |
#, fuzzy |
| 1004 |
msgid "Scene Upload:" |
| 1005 |
msgstr "Przesyłanie sceny:" |
| 1006 |
|
| 1007 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2772 |
| 1008 |
#, fuzzy |
| 1009 |
msgid "Upload" |
| 1010 |
msgstr "Przesyłanie sceny" |
| 1011 |
|
| 1012 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2797 |
| 1013 |
msgid "" |
| 1014 |
"You can add any logo size. But recommended size is below 100x100 px for " |
| 1015 |
"perfect look." |
| 1016 |
msgstr "" |
| 1017 |
|
| 1018 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2816 |
| 1019 |
msgid "Company Details : " |
| 1020 |
msgstr "" |
| 1021 |
|
| 1022 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2939 |
| 1023 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4707 |
| 1024 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4717 |
| 1025 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4819 |
| 1026 |
msgid "Color" |
| 1027 |
msgstr "zafarb" |
| 1028 |
|
| 1029 |
#: legacy/admin/classes/class-wpvr-meta-field.php:2946 |
| 1030 |
msgid "Icon" |
| 1031 |
msgstr "" |
| 1032 |
|
| 1033 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3018 |
| 1034 |
#, fuzzy |
| 1035 |
msgid "Upload icon" |
| 1036 |
msgstr "Prześlij lub dodaj link" |
| 1037 |
|
| 1038 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3020 |
| 1039 |
msgid "Click to" |
| 1040 |
msgstr "" |
| 1041 |
|
| 1042 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3020 |
| 1043 |
#, fuzzy |
| 1044 |
msgid "Upload an Image" |
| 1045 |
msgstr "Prześlij obraz panoramy" |
| 1046 |
|
| 1047 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3025 |
| 1048 |
msgid "This option will not work if the \"Tour Autoload\" is turned on." |
| 1049 |
msgstr "Ta opcja nie zadziała, jeśli wł� |
| 1050 |
czono „Tour Autoload”." |
| 1051 |
|
| 1052 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3354 |
| 1053 |
msgid "Classic Layout" |
| 1054 |
msgstr "" |
| 1055 |
|
| 1056 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3367 |
| 1057 |
msgid "Modern Layout" |
| 1058 |
msgstr "" |
| 1059 |
|
| 1060 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3659 |
| 1061 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3712 |
| 1062 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4455 |
| 1063 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4516 |
| 1064 |
msgid "Info" |
| 1065 |
msgstr "info" |
| 1066 |
|
| 1067 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3660 |
| 1068 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3713 |
| 1069 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4456 |
| 1070 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4517 |
| 1071 |
#, fuzzy |
| 1072 |
msgid "Scene" |
| 1073 |
msgstr "scenki" |
| 1074 |
|
| 1075 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3671 |
| 1076 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4467 |
| 1077 |
msgid "" |
| 1078 |
"Choose the type of hotspot: Info (displays information) or Scene (links to " |
| 1079 |
"another scene)." |
| 1080 |
msgstr "" |
| 1081 |
|
| 1082 |
#: legacy/admin/classes/class-wpvr-meta-field.php:3860 |
| 1083 |
msgid "Tooltip Icon" |
| 1084 |
msgstr "" |
| 1085 |
|
| 1086 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4116 |
| 1087 |
msgid "Select a custom icon for the hotspot." |
| 1088 |
msgstr "" |
| 1089 |
|
| 1090 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4174 |
| 1091 |
msgid "Set a custom background color for the hotspot." |
| 1092 |
msgstr "" |
| 1093 |
|
| 1094 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4218 |
| 1095 |
msgid "Set a custom color for the hotspot icon." |
| 1096 |
msgstr "" |
| 1097 |
|
| 1098 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4263 |
| 1099 |
msgid "Enable an animation for the hotspot." |
| 1100 |
msgstr "" |
| 1101 |
|
| 1102 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4308 |
| 1103 |
msgid "" |
| 1104 |
"Add a border around the hotspot with customizable color, style, and " |
| 1105 |
"thickness." |
| 1106 |
msgstr "" |
| 1107 |
|
| 1108 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4419 |
| 1109 |
msgid "Select the shape of the hotspot (e.g., Rounded, square, and Hexagon)." |
| 1110 |
msgstr "" |
| 1111 |
|
| 1112 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4698 |
| 1113 |
msgid "Open in new tab" |
| 1114 |
msgstr "Otwórz w nowej karcie" |
| 1115 |
|
| 1116 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4705 |
| 1117 |
#, fuzzy |
| 1118 |
msgid "Background Color :" |
| 1119 |
msgstr "Kolor tła" |
| 1120 |
|
| 1121 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4714 |
| 1122 |
#, fuzzy |
| 1123 |
msgid "Font color :" |
| 1124 |
msgstr "kolor czcionki" |
| 1125 |
|
| 1126 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4724 |
| 1127 |
#, fuzzy |
| 1128 |
msgid "Font Size (px) :" |
| 1129 |
msgstr "Rozmiar czcionki (PX)" |
| 1130 |
|
| 1131 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4729 |
| 1132 |
#, fuzzy |
| 1133 |
msgid "Font Weight :" |
| 1134 |
msgstr "Waga czcion" |
| 1135 |
|
| 1136 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4741 |
| 1137 |
#, fuzzy |
| 1138 |
msgid "Line Height :" |
| 1139 |
msgstr "Wysokość linii" |
| 1140 |
|
| 1141 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4746 |
| 1142 |
#, fuzzy |
| 1143 |
msgid "Text Decoration :" |
| 1144 |
msgstr "Dekoracja tekstu" |
| 1145 |
|
| 1146 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4748 |
| 1147 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4758 |
| 1148 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4933 |
| 1149 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:41 legacy/src/index.js:41 |
| 1150 |
#: legacy/src/index.js:72 |
| 1151 |
msgid "None" |
| 1152 |
msgstr "żaden" |
| 1153 |
|
| 1154 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4749 |
| 1155 |
msgid "Underline" |
| 1156 |
msgstr "uwydatniać" |
| 1157 |
|
| 1158 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4750 |
| 1159 |
msgid "Overline" |
| 1160 |
msgstr "wyci� |
| 1161 |
ć" |
| 1162 |
|
| 1163 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4751 |
| 1164 |
msgid "Line Through" |
| 1165 |
msgstr "przejechać" |
| 1166 |
|
| 1167 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4756 |
| 1168 |
#, fuzzy |
| 1169 |
msgid "Text Transform :" |
| 1170 |
msgstr "Przekształć tekst" |
| 1171 |
|
| 1172 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4759 |
| 1173 |
msgid "Uppercase" |
| 1174 |
msgstr "wielkie litery" |
| 1175 |
|
| 1176 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4760 |
| 1177 |
msgid "Lowercase" |
| 1178 |
msgstr "małe litery" |
| 1179 |
|
| 1180 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4761 |
| 1181 |
msgid "Capitalize" |
| 1182 |
msgstr "spieniężać" |
| 1183 |
|
| 1184 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4766 |
| 1185 |
#, fuzzy |
| 1186 |
msgid "Button Alignment :" |
| 1187 |
msgstr "Wyrównanie przycisków" |
| 1188 |
|
| 1189 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4768 |
| 1190 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4846 |
| 1191 |
msgid "Left" |
| 1192 |
msgstr "lewo" |
| 1193 |
|
| 1194 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4769 |
| 1195 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4836 |
| 1196 |
msgid "Right" |
| 1197 |
msgstr "w porz� |
| 1198 |
dku" |
| 1199 |
|
| 1200 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4770 |
| 1201 |
msgid "Center" |
| 1202 |
msgstr "skupisko" |
| 1203 |
|
| 1204 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4771 |
| 1205 |
msgid "Justified" |
| 1206 |
msgstr "usprawiedliwiony" |
| 1207 |
|
| 1208 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4776 |
| 1209 |
#, fuzzy |
| 1210 |
msgid "Font Style :" |
| 1211 |
msgstr "Styl czcionki" |
| 1212 |
|
| 1213 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4778 |
| 1214 |
msgid "Normal" |
| 1215 |
msgstr "normalny" |
| 1216 |
|
| 1217 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4779 |
| 1218 |
msgid "Italic" |
| 1219 |
msgstr "italski" |
| 1220 |
|
| 1221 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4780 |
| 1222 |
msgid "Oblique" |
| 1223 |
msgstr "skośny" |
| 1224 |
|
| 1225 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4785 |
| 1226 |
#, fuzzy |
| 1227 |
msgid "Letter Spacing (px) :" |
| 1228 |
msgstr "Rozstaw liter (PX)" |
| 1229 |
|
| 1230 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4790 |
| 1231 |
#, fuzzy |
| 1232 |
msgid "Word Spacing (px) :" |
| 1233 |
msgstr "Odstępy słów (PX)" |
| 1234 |
|
| 1235 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4795 |
| 1236 |
#, fuzzy |
| 1237 |
msgid "Border Radius (px) :" |
| 1238 |
msgstr "Promień granicy (PX)" |
| 1239 |
|
| 1240 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4800 |
| 1241 |
#, fuzzy |
| 1242 |
msgid "Border :" |
| 1243 |
msgstr "okalać" |
| 1244 |
|
| 1245 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4803 |
| 1246 |
msgid "Width (px)" |
| 1247 |
msgstr "Szerokość (Px)" |
| 1248 |
|
| 1249 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4808 |
| 1250 |
msgid "Style" |
| 1251 |
msgstr "wskazówka zegar" |
| 1252 |
|
| 1253 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4828 |
| 1254 |
#, fuzzy |
| 1255 |
msgid "Padding (px) :" |
| 1256 |
msgstr "Wyściółka (PX)" |
| 1257 |
|
| 1258 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4831 |
| 1259 |
msgid "Top" |
| 1260 |
msgstr "buda woz" |
| 1261 |
|
| 1262 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4841 |
| 1263 |
msgid "Bottom" |
| 1264 |
msgstr "spód" |
| 1265 |
|
| 1266 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4934 |
| 1267 |
msgid "Circle Crop" |
| 1268 |
msgstr "" |
| 1269 |
|
| 1270 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4936 |
| 1271 |
msgid "Zoom In" |
| 1272 |
msgstr "pomakżyć" |
| 1273 |
|
| 1274 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4937 |
| 1275 |
#, fuzzy |
| 1276 |
msgid "Zoom In Up" |
| 1277 |
msgstr "pomakżyć" |
| 1278 |
|
| 1279 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4938 |
| 1280 |
#, fuzzy |
| 1281 |
msgid "Zoom In Down" |
| 1282 |
msgstr "pomakżyć" |
| 1283 |
|
| 1284 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4939 |
| 1285 |
#, fuzzy |
| 1286 |
msgid "Zoom In Left" |
| 1287 |
msgstr "pomakżyć" |
| 1288 |
|
| 1289 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4940 |
| 1290 |
#, fuzzy |
| 1291 |
msgid "Zoom In Right" |
| 1292 |
msgstr "pomakżyć" |
| 1293 |
|
| 1294 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4942 |
| 1295 |
msgid "Slide In Up" |
| 1296 |
msgstr "" |
| 1297 |
|
| 1298 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4943 |
| 1299 |
msgid "Slide In Down" |
| 1300 |
msgstr "" |
| 1301 |
|
| 1302 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4944 |
| 1303 |
msgid "Slide In Left" |
| 1304 |
msgstr "" |
| 1305 |
|
| 1306 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4945 |
| 1307 |
msgid "Slide In Right" |
| 1308 |
msgstr "" |
| 1309 |
|
| 1310 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4947 |
| 1311 |
msgid "Fade With Blur" |
| 1312 |
msgstr "" |
| 1313 |
|
| 1314 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4948 |
| 1315 |
msgid "Fade In" |
| 1316 |
msgstr "" |
| 1317 |
|
| 1318 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4949 |
| 1319 |
msgid "Fade In Up" |
| 1320 |
msgstr "" |
| 1321 |
|
| 1322 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4950 |
| 1323 |
msgid "Fade In Down" |
| 1324 |
msgstr "" |
| 1325 |
|
| 1326 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4951 |
| 1327 |
msgid "Fade In Left" |
| 1328 |
msgstr "" |
| 1329 |
|
| 1330 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4952 |
| 1331 |
#, fuzzy |
| 1332 |
msgid "Fade In Right" |
| 1333 |
msgstr "Ruszaj w prawo" |
| 1334 |
|
| 1335 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4953 |
| 1336 |
msgid "Fade In Top Left" |
| 1337 |
msgstr "" |
| 1338 |
|
| 1339 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4954 |
| 1340 |
msgid "Fade In Top Right" |
| 1341 |
msgstr "" |
| 1342 |
|
| 1343 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4955 |
| 1344 |
msgid "Fade In Bottom Left" |
| 1345 |
msgstr "" |
| 1346 |
|
| 1347 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4956 |
| 1348 |
msgid "Fade In Bottom Right" |
| 1349 |
msgstr "" |
| 1350 |
|
| 1351 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4958 |
| 1352 |
msgid "Back In Left" |
| 1353 |
msgstr "" |
| 1354 |
|
| 1355 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4959 |
| 1356 |
msgid "Back In Right" |
| 1357 |
msgstr "" |
| 1358 |
|
| 1359 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4960 |
| 1360 |
msgid "Back In Up" |
| 1361 |
msgstr "" |
| 1362 |
|
| 1363 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4961 |
| 1364 |
msgid "Back In Down" |
| 1365 |
msgstr "" |
| 1366 |
|
| 1367 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4963 |
| 1368 |
msgid "Bounce In" |
| 1369 |
msgstr "" |
| 1370 |
|
| 1371 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4964 |
| 1372 |
msgid "Bounce In Up" |
| 1373 |
msgstr "" |
| 1374 |
|
| 1375 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4965 |
| 1376 |
#, fuzzy |
| 1377 |
msgid "Bounce In Down" |
| 1378 |
msgstr "opuszczać" |
| 1379 |
|
| 1380 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4966 |
| 1381 |
#, fuzzy |
| 1382 |
msgid "Bounce In Left" |
| 1383 |
msgstr "Przesuń się w lewo" |
| 1384 |
|
| 1385 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4967 |
| 1386 |
#, fuzzy |
| 1387 |
msgid "Bounce In Right" |
| 1388 |
msgstr "Ruszaj w prawo" |
| 1389 |
|
| 1390 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4969 |
| 1391 |
msgid "Flip" |
| 1392 |
msgstr "" |
| 1393 |
|
| 1394 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4970 |
| 1395 |
msgid "Flip X" |
| 1396 |
msgstr "" |
| 1397 |
|
| 1398 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4971 |
| 1399 |
msgid "Flip Y" |
| 1400 |
msgstr "" |
| 1401 |
|
| 1402 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4973 |
| 1403 |
msgid "Light Speed In Left" |
| 1404 |
msgstr "" |
| 1405 |
|
| 1406 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4974 |
| 1407 |
msgid "Light Speed In Right" |
| 1408 |
msgstr "" |
| 1409 |
|
| 1410 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4976 |
| 1411 |
msgid "Rotate In" |
| 1412 |
msgstr "" |
| 1413 |
|
| 1414 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4977 |
| 1415 |
msgid "Rotate In Up Left" |
| 1416 |
msgstr "" |
| 1417 |
|
| 1418 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4978 |
| 1419 |
msgid "Rotate In Up Right" |
| 1420 |
msgstr "" |
| 1421 |
|
| 1422 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4979 |
| 1423 |
msgid "Rotate In Down Left" |
| 1424 |
msgstr "" |
| 1425 |
|
| 1426 |
#: legacy/admin/classes/class-wpvr-meta-field.php:4980 |
| 1427 |
msgid "Rotate In Down Right" |
| 1428 |
msgstr "" |
| 1429 |
|
| 1430 |
#: legacy/admin/classes/class-wpvr-meta-field.php:5034 |
| 1431 |
msgid "All Membership Levels" |
| 1432 |
msgstr "" |
| 1433 |
|
| 1434 |
#: legacy/admin/classes/class-wpvr-meta-field.php:5789 |
| 1435 |
msgid "Large" |
| 1436 |
msgstr "" |
| 1437 |
|
| 1438 |
#: legacy/admin/classes/class-wpvr-meta-field.php:5790 |
| 1439 |
msgid "Small" |
| 1440 |
msgstr "" |
| 1441 |
|
| 1442 |
#: legacy/admin/classes/class-wpvr-occasion-banner.php:120 |
| 1443 |
msgid "4th of july special offer logo" |
| 1444 |
msgstr "" |
| 1445 |
|
| 1446 |
#: legacy/admin/classes/class-wpvr-occasion-banner.php:124 |
| 1447 |
msgid "Biggest sale of the year!" |
| 1448 |
msgstr "" |
| 1449 |
|
| 1450 |
#: legacy/admin/classes/class-wpvr-occasion-banner.php:128 |
| 1451 |
msgid "4th of july special discount" |
| 1452 |
msgstr "" |
| 1453 |
|
| 1454 |
#: legacy/admin/classes/class-wpvr-occasion-banner.php:133 |
| 1455 |
msgid "Offer Countdown" |
| 1456 |
msgstr "" |
| 1457 |
|
| 1458 |
#: legacy/admin/classes/class-wpvr-occasion-banner.php:152 |
| 1459 |
msgid "Click to view 4th of july sale products" |
| 1460 |
msgstr "" |
| 1461 |
|
| 1462 |
#: legacy/admin/classes/class-wpvr-occasion-banner.php:154 |
| 1463 |
msgid "Get The Deal" |
| 1464 |
msgstr "" |
| 1465 |
|
| 1466 |
#: legacy/admin/classes/class-wpvr-onboarding-notice.php:288 |
| 1467 |
msgid "" |
| 1468 |
"You haven't created a virtual tour yet. Our quick setup wizard will help you " |
| 1469 |
"publish your first tour in minutes!" |
| 1470 |
msgstr "" |
| 1471 |
|
| 1472 |
#: legacy/admin/classes/class-wpvr-onboarding-notice.php:293 |
| 1473 |
msgid "Start setup wizard" |
| 1474 |
msgstr "" |
| 1475 |
|
| 1476 |
#: legacy/admin/classes/class-wpvr-onboarding-notice.php:300 |
| 1477 |
#: src/Admin/UiModeSwitcher.php:134 |
| 1478 |
msgid "Dismiss this notice" |
| 1479 |
msgstr "" |
| 1480 |
|
| 1481 |
#: legacy/admin/classes/class-wpvr-onboarding-notice.php:301 |
| 1482 |
msgid "Dismiss" |
| 1483 |
msgstr "" |
| 1484 |
|
| 1485 |
#: legacy/admin/classes/class-wpvr-post-type.php:98 |
| 1486 |
#: legacy/admin/classes/class-wpvr-post-type.php:184 |
| 1487 |
msgid "Create Tour" |
| 1488 |
msgstr "" |
| 1489 |
|
| 1490 |
#: legacy/admin/classes/class-wpvr-post-type.php:107 |
| 1491 |
#, fuzzy |
| 1492 |
msgid "Select your preferred tour" |
| 1493 |
msgstr "Wybierz swój formularz" |
| 1494 |
|
| 1495 |
#: legacy/admin/classes/class-wpvr-post-type.php:117 |
| 1496 |
msgid "360 Image Tour" |
| 1497 |
msgstr "" |
| 1498 |
|
| 1499 |
#: legacy/admin/classes/class-wpvr-post-type.php:128 |
| 1500 |
#, fuzzy |
| 1501 |
msgid "360 Video Tour" |
| 1502 |
msgstr "Wsparcie wideo 360" |
| 1503 |
|
| 1504 |
#: legacy/admin/classes/class-wpvr-post-type.php:174 src/Admin/Admin.php:497 |
| 1505 |
msgid "Tour Name" |
| 1506 |
msgstr "" |
| 1507 |
|
| 1508 |
#: legacy/admin/classes/class-wpvr-post-type.php:182 |
| 1509 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:198 |
| 1510 |
#: src/Admin/Admin.php:568 app/components/modals/CreateSceneModal.jsx:638 |
| 1511 |
msgid "Cancel" |
| 1512 |
msgstr "" |
| 1513 |
|
| 1514 |
#: legacy/admin/classes/class-wpvr-post-type.php:367 src/Admin/Admin.php:57 |
| 1515 |
#: src/Admin/Admin.php:234 src/Admin/Admin.php:357 |
| 1516 |
#, fuzzy |
| 1517 |
msgid "Edit Tour" |
| 1518 |
msgstr "koniec wycieczki" |
| 1519 |
|
| 1520 |
#: legacy/admin/classes/class-wpvr-post-type.php:368 |
| 1521 |
#: src/Api/Services/TourService.php:244 |
| 1522 |
#, fuzzy |
| 1523 |
msgid "New Tour" |
| 1524 |
msgstr "Dodaj now� |
| 1525 |
wycieczkę" |
| 1526 |
|
| 1527 |
#: legacy/admin/classes/class-wpvr-post-type.php:369 |
| 1528 |
#, fuzzy |
| 1529 |
msgid "View Tour" |
| 1530 |
msgstr "wycieczka z przewodnikiem" |
| 1531 |
|
| 1532 |
#: legacy/admin/classes/class-wpvr-post-type.php:370 |
| 1533 |
#, fuzzy |
| 1534 |
msgid "Search WP VR Tour" |
| 1535 |
msgstr "Identyfikator trasy WPVR" |
| 1536 |
|
| 1537 |
#: legacy/admin/classes/class-wpvr-post-type.php:371 |
| 1538 |
#, fuzzy |
| 1539 |
msgid "No WP VR Tour found" |
| 1540 |
msgstr "Identyfikator trasy WPVR" |
| 1541 |
|
| 1542 |
#: legacy/admin/classes/class-wpvr-post-type.php:372 |
| 1543 |
msgid "No WP VR Tour found in Trash" |
| 1544 |
msgstr "" |
| 1545 |
|
| 1546 |
#: legacy/admin/classes/class-wpvr-post-type.php:374 |
| 1547 |
#, fuzzy |
| 1548 |
msgid "All Tours" |
| 1549 |
msgstr "wycieczki" |
| 1550 |
|
| 1551 |
#: legacy/admin/classes/class-wpvr-post-type.php:375 |
| 1552 |
#: legacy/oxygen/WPVR_OXY_INTEGRATION.php:38 |
| 1553 |
msgid "WP VR" |
| 1554 |
msgstr "WP VR" |
| 1555 |
|
| 1556 |
#: legacy/admin/classes/class-wpvr-post-type.php:428 |
| 1557 |
#, fuzzy |
| 1558 |
msgid "Title" |
| 1559 |
msgstr "Tytuł sceny" |
| 1560 |
|
| 1561 |
#: legacy/admin/classes/class-wpvr-post-type.php:429 |
| 1562 |
msgid "Tour Thumbnail" |
| 1563 |
msgstr "" |
| 1564 |
|
| 1565 |
#: legacy/admin/classes/class-wpvr-post-type.php:430 |
| 1566 |
#, fuzzy |
| 1567 |
msgid "Shortcode" |
| 1568 |
msgstr "Dodaj krótki kod formularza" |
| 1569 |
|
| 1570 |
#: legacy/admin/classes/class-wpvr-post-type.php:431 src/Admin/Admin.php:514 |
| 1571 |
msgid "Tour Type" |
| 1572 |
msgstr "" |
| 1573 |
|
| 1574 |
#: legacy/admin/classes/class-wpvr-post-type.php:432 |
| 1575 |
msgid "Author" |
| 1576 |
msgstr "" |
| 1577 |
|
| 1578 |
#: legacy/admin/classes/class-wpvr-post-type.php:433 |
| 1579 |
msgid "Date" |
| 1580 |
msgstr "" |
| 1581 |
|
| 1582 |
#: legacy/admin/classes/class-wpvr-post-type.php:597 |
| 1583 |
#: legacy/admin/classes/class-wpvr-post-type.php:598 |
| 1584 |
msgid "WP VR item updated." |
| 1585 |
msgstr "" |
| 1586 |
|
| 1587 |
#: legacy/admin/classes/class-wpvr-sample-tour.php:75 |
| 1588 |
msgid "Failed to initialize WP_Filesystem" |
| 1589 |
msgstr "" |
| 1590 |
|
| 1591 |
#: legacy/admin/classes/class-wpvr-scene.php:232 |
| 1592 |
#: legacy/admin/classes/class-wpvr-scene.php:261 |
| 1593 |
#, fuzzy |
| 1594 |
msgid "Scene Settings" |
| 1595 |
msgstr "Ustawienie sceny" |
| 1596 |
|
| 1597 |
#: legacy/admin/classes/class-wpvr-scene.php:672 |
| 1598 |
#: legacy/bricks/Wpvr-widget.php:186 |
| 1599 |
msgid "Bricks Editor Mode - WPVR Preview is not available." |
| 1600 |
msgstr "" |
| 1601 |
|
| 1602 |
#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:82 |
| 1603 |
msgid "Close banner" |
| 1604 |
msgstr "" |
| 1605 |
|
| 1606 |
#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:108 |
| 1607 |
msgid "Eid Mubarak, Save Big" |
| 1608 |
msgstr "" |
| 1609 |
|
| 1610 |
#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:113 |
| 1611 |
msgid "Up to 50% Off" |
| 1612 |
msgstr "" |
| 1613 |
|
| 1614 |
#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:145 |
| 1615 |
msgid "Claim Your Deal on Eid-Ul-Fitr" |
| 1616 |
msgstr "" |
| 1617 |
|
| 1618 |
#: legacy/admin/classes/class-wpvr-sells-notification-bar.php:146 |
| 1619 |
msgid "Claim Your Deal" |
| 1620 |
msgstr "" |
| 1621 |
|
| 1622 |
#: legacy/admin/classes/class-wpvr-shortcode.php:36 |
| 1623 |
msgid "For Classic Editor:" |
| 1624 |
msgstr "Dla klasycznego edytora:" |
| 1625 |
|
| 1626 |
#: legacy/admin/classes/class-wpvr-shortcode.php:39 |
| 1627 |
msgid "" |
| 1628 |
"To use this WP VR tour in your posts or pages use the following shortcode " |
| 1629 |
msgstr "" |
| 1630 |
"Aby użyć tego WP VR Tour w swoich postach lub stronach, użyj następuj� |
| 1631 |
cego " |
| 1632 |
"skrótu kodu" |
| 1633 |
|
| 1634 |
#: legacy/admin/classes/class-wpvr-video.php:46 |
| 1635 |
msgid "Video Settings : " |
| 1636 |
msgstr "Ustawienia wideo:" |
| 1637 |
|
| 1638 |
#: legacy/admin/classes/class-wpvr-video.php:93 |
| 1639 |
#: legacy/admin/classes/class-wpvr-video.php:152 |
| 1640 |
msgid "panoid" |
| 1641 |
msgstr "" |
| 1642 |
|
| 1643 |
#: legacy/admin/classes/class-wpvr-video.php:94 |
| 1644 |
msgid "panoviddata" |
| 1645 |
msgstr "" |
| 1646 |
|
| 1647 |
#: legacy/admin/classes/class-wpvr-video.php:95 |
| 1648 |
#: legacy/admin/classes/class-wpvr-video.php:152 |
| 1649 |
msgid "vidid" |
| 1650 |
msgstr "" |
| 1651 |
|
| 1652 |
#: legacy/admin/classes/class-wpvr-video.php:96 |
| 1653 |
msgid "vidurl" |
| 1654 |
msgstr "" |
| 1655 |
|
| 1656 |
#: legacy/admin/classes/class-wpvr-video.php:97 |
| 1657 |
#: legacy/admin/classes/class-wpvr-video.php:152 |
| 1658 |
msgid "vidtype" |
| 1659 |
msgstr "" |
| 1660 |
|
| 1661 |
#: legacy/admin/classes/class-wpvr-video.php:98 |
| 1662 |
msgid "autoplay" |
| 1663 |
msgstr "" |
| 1664 |
|
| 1665 |
#: legacy/admin/classes/class-wpvr-video.php:99 |
| 1666 |
msgid "loop" |
| 1667 |
msgstr "" |
| 1668 |
|
| 1669 |
#: legacy/admin/classes/class-wpvr-video.php:152 |
| 1670 |
msgid "panodata" |
| 1671 |
msgstr "" |
| 1672 |
|
| 1673 |
#: legacy/admin/partials/wpvr-premium-feature-popup.php:54 |
| 1674 |
#: legacy/admin/partials/wpvr_confirmation_alert.php:510 |
| 1675 |
#, fuzzy |
| 1676 |
msgid "This is a Premium Feature" |
| 1677 |
msgstr "Funkcje premium" |
| 1678 |
|
| 1679 |
#: legacy/admin/partials/wpvr-premium-feature-popup.php:58 |
| 1680 |
#: legacy/admin/partials/wpvr_confirmation_alert.php:514 |
| 1681 |
msgid "Upgrade to Pro to unlock this and start using the feature." |
| 1682 |
msgstr "" |
| 1683 |
|
| 1684 |
#. translators: %s: Discount price |
| 1685 |
#: legacy/admin/partials/wpvr-premium-feature-popup.php:83 |
| 1686 |
#: legacy/admin/partials/wpvr_confirmation_alert.php:539 |
| 1687 |
#, php-format |
| 1688 |
msgid "Starting at %s/year" |
| 1689 |
msgstr "" |
| 1690 |
|
| 1691 |
#. translators: %s: Original price |
| 1692 |
#: legacy/admin/partials/wpvr-premium-feature-popup.php:87 |
| 1693 |
#: legacy/admin/partials/wpvr_confirmation_alert.php:543 |
| 1694 |
#, php-format |
| 1695 |
msgid "Normally %s/year" |
| 1696 |
msgstr "" |
| 1697 |
|
| 1698 |
#: legacy/admin/partials/wpvr-premium-feature-popup.php:94 |
| 1699 |
#: legacy/admin/partials/wpvr_confirmation_alert.php:550 |
| 1700 |
#, fuzzy |
| 1701 |
msgid "Upgrade to PRO Now" |
| 1702 |
msgstr "Uaktualnij do Pro" |
| 1703 |
|
| 1704 |
#: legacy/admin/partials/wpvr-review-request-body-content.php:4 |
| 1705 |
msgid "" |
| 1706 |
"Hey, I noticed you've made nice tour with WP VR! Are you enjoying WP VR?" |
| 1707 |
msgstr "" |
| 1708 |
|
| 1709 |
#: legacy/admin/partials/wpvr-review-request-body-content.php:7 |
| 1710 |
msgid "Not Really" |
| 1711 |
msgstr "" |
| 1712 |
|
| 1713 |
#: legacy/admin/partials/wpvr-review-request-body-content.php:18 |
| 1714 |
msgid "" |
| 1715 |
"That's awesome! Could you please do me a BIG favor and give it a rating on " |
| 1716 |
"WordPress to help us grow and motivate us?" |
| 1717 |
msgstr "" |
| 1718 |
|
| 1719 |
#: legacy/admin/partials/wpvr-review-request-body-content.php:18 |
| 1720 |
msgid "Lincoln Islam" |
| 1721 |
msgstr "" |
| 1722 |
|
| 1723 |
#: legacy/admin/partials/wpvr-review-request-body-content.php:21 |
| 1724 |
msgid "Already given" |
| 1725 |
msgstr "" |
| 1726 |
|
| 1727 |
#: legacy/admin/partials/wpvr-review-request-body-content.php:22 |
| 1728 |
msgid "No thanks" |
| 1729 |
msgstr "" |
| 1730 |
|
| 1731 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:17 |
| 1732 |
#, fuzzy |
| 1733 |
msgid "WP VR - Setup Wizard" |
| 1734 |
msgstr "Konfiguracja WPVR" |
| 1735 |
|
| 1736 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:35 |
| 1737 |
msgid "Remind me later" |
| 1738 |
msgstr "" |
| 1739 |
|
| 1740 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:56 |
| 1741 |
msgid "What are you creating a virtual tour for?" |
| 1742 |
msgstr "" |
| 1743 |
|
| 1744 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:57 |
| 1745 |
msgid "We'll set things up with the right template for you." |
| 1746 |
msgstr "" |
| 1747 |
|
| 1748 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:62 |
| 1749 |
msgid "Real Estate" |
| 1750 |
msgstr "" |
| 1751 |
|
| 1752 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:63 |
| 1753 |
msgid "Show property without a visit" |
| 1754 |
msgstr "" |
| 1755 |
|
| 1756 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:67 |
| 1757 |
msgid "Hotels & Resorts" |
| 1758 |
msgstr "" |
| 1759 |
|
| 1760 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:68 |
| 1761 |
msgid "Experience before booking" |
| 1762 |
msgstr "" |
| 1763 |
|
| 1764 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:72 |
| 1765 |
msgid "Educational Institutions" |
| 1766 |
msgstr "" |
| 1767 |
|
| 1768 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:73 |
| 1769 |
msgid "Campus tours & admissions" |
| 1770 |
msgstr "" |
| 1771 |
|
| 1772 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:77 |
| 1773 |
msgid "E-commerce" |
| 1774 |
msgstr "" |
| 1775 |
|
| 1776 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:78 |
| 1777 |
msgid "Virtual shopping experience" |
| 1778 |
msgstr "" |
| 1779 |
|
| 1780 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:82 |
| 1781 |
msgid "Exhibitions" |
| 1782 |
msgstr "" |
| 1783 |
|
| 1784 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:83 |
| 1785 |
msgid "Art & gallery showcases" |
| 1786 |
msgstr "" |
| 1787 |
|
| 1788 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:87 |
| 1789 |
msgid "Offices" |
| 1790 |
msgstr "" |
| 1791 |
|
| 1792 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:88 |
| 1793 |
msgid "Virtual office tours" |
| 1794 |
msgstr "" |
| 1795 |
|
| 1796 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:92 |
| 1797 |
msgid "Showrooms" |
| 1798 |
msgstr "" |
| 1799 |
|
| 1800 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:93 |
| 1801 |
msgid "Virtual showroom experiences" |
| 1802 |
msgstr "" |
| 1803 |
|
| 1804 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:98 |
| 1805 |
msgid "Skip — I'll upload my own image" |
| 1806 |
msgstr "" |
| 1807 |
|
| 1808 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:112 |
| 1809 |
msgid "Show your property without another site visit" |
| 1810 |
msgstr "" |
| 1811 |
|
| 1812 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:113 |
| 1813 |
msgid "Most agents publish their first property tour in minutes." |
| 1814 |
msgstr "" |
| 1815 |
|
| 1816 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:121 |
| 1817 |
msgid "Upload my own 360 photo" |
| 1818 |
msgstr "" |
| 1819 |
|
| 1820 |
#. translators: %s: link to browse |
| 1821 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:127 |
| 1822 |
#, php-format |
| 1823 |
msgid "Drag & drop your 360° image or %s" |
| 1824 |
msgstr "" |
| 1825 |
|
| 1826 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:128 |
| 1827 |
msgid "click to browse" |
| 1828 |
msgstr "" |
| 1829 |
|
| 1830 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:136 |
| 1831 |
msgid "Supported files: JPEG, PNG, WebP" |
| 1832 |
msgstr "" |
| 1833 |
|
| 1834 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:141 |
| 1835 |
msgid "USE PROPERTY TEMPLATE" |
| 1836 |
msgstr "" |
| 1837 |
|
| 1838 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:148 |
| 1839 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:208 |
| 1840 |
msgid "Back" |
| 1841 |
msgstr "" |
| 1842 |
|
| 1843 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:159 |
| 1844 |
msgid "This is how buyers will experience your listing" |
| 1845 |
msgstr "" |
| 1846 |
|
| 1847 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:160 |
| 1848 |
msgid "Interactive, immersive, and accessible on any device." |
| 1849 |
msgstr "" |
| 1850 |
|
| 1851 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:166 |
| 1852 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:173 |
| 1853 |
msgid "Drag to rotate" |
| 1854 |
msgstr "" |
| 1855 |
|
| 1856 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:167 |
| 1857 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:174 |
| 1858 |
msgid "Scroll to zoom" |
| 1859 |
msgstr "" |
| 1860 |
|
| 1861 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:168 |
| 1862 |
#, fuzzy |
| 1863 |
msgid "Click to add hotspot" |
| 1864 |
msgstr "Dodajmy hotspot" |
| 1865 |
|
| 1866 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:191 |
| 1867 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:199 |
| 1868 |
#, fuzzy |
| 1869 |
msgid "Add Hotspot" |
| 1870 |
msgstr "gor� |
| 1871 |
cy miejsce" |
| 1872 |
|
| 1873 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:195 |
| 1874 |
#, fuzzy |
| 1875 |
msgid "Hotspot Text" |
| 1876 |
msgstr "Hotspot-typ" |
| 1877 |
|
| 1878 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:196 |
| 1879 |
msgid "Enter information about this location..." |
| 1880 |
msgstr "" |
| 1881 |
|
| 1882 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:211 |
| 1883 |
#, fuzzy |
| 1884 |
msgid "Publish Tour" |
| 1885 |
msgstr "Opublikuj swoj� |
| 1886 |
wycieczkę" |
| 1887 |
|
| 1888 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:221 |
| 1889 |
msgid "Your tour is published!" |
| 1890 |
msgstr "" |
| 1891 |
|
| 1892 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:222 |
| 1893 |
msgid "" |
| 1894 |
"Your virtual tour has been created and is ready to be displayed on your " |
| 1895 |
"website." |
| 1896 |
msgstr "" |
| 1897 |
|
| 1898 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:229 |
| 1899 |
#, fuzzy |
| 1900 |
msgid "Edit Your Tour" |
| 1901 |
msgstr "Zapisz swoj� |
| 1902 |
wycieczkę" |
| 1903 |
|
| 1904 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:237 |
| 1905 |
msgid "I agree to share non-sensitive diagnostic data to help improve WP VR." |
| 1906 |
msgstr "" |
| 1907 |
|
| 1908 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:238 |
| 1909 |
msgid "(You can change this in WP VR settings anytime)" |
| 1910 |
msgstr "" |
| 1911 |
|
| 1912 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:244 |
| 1913 |
msgid "Start Over" |
| 1914 |
msgstr "" |
| 1915 |
|
| 1916 |
#: legacy/admin/partials/wpvr-setup-wizard-views.php:246 |
| 1917 |
msgid "Go to listing" |
| 1918 |
msgstr "" |
| 1919 |
|
| 1920 |
#: legacy/admin/partials/wpvr_checklist_template.php:16 |
| 1921 |
#, fuzzy |
| 1922 |
msgid "Add at least one scene" |
| 1923 |
msgstr "Dodawanie hotspotów na scenie" |
| 1924 |
|
| 1925 |
#: legacy/admin/partials/wpvr_checklist_template.php:27 |
| 1926 |
msgid "Upload your first 360° image or video." |
| 1927 |
msgstr "" |
| 1928 |
|
| 1929 |
#: legacy/admin/partials/wpvr_checklist_template.php:36 |
| 1930 |
msgid "Upload 360° media" |
| 1931 |
msgstr "" |
| 1932 |
|
| 1933 |
#: legacy/admin/partials/wpvr_checklist_template.php:47 |
| 1934 |
msgid "Ensure media is self-hosted or from YouTube/Vimeo." |
| 1935 |
msgstr "" |
| 1936 |
|
| 1937 |
#: legacy/admin/partials/wpvr_checklist_template.php:56 |
| 1938 |
#, fuzzy |
| 1939 |
msgid "Set a default scene" |
| 1940 |
msgstr "Ustaw jako domyślny" |
| 1941 |
|
| 1942 |
#: legacy/admin/partials/wpvr_checklist_template.php:67 |
| 1943 |
msgid "Choose where users will start the tour." |
| 1944 |
msgstr "" |
| 1945 |
|
| 1946 |
#: legacy/admin/partials/wpvr_checklist_template.php:76 |
| 1947 |
msgid "Add navigation hotspots" |
| 1948 |
msgstr "" |
| 1949 |
|
| 1950 |
#: legacy/admin/partials/wpvr_checklist_template.php:87 |
| 1951 |
msgid "Link different scenes or add interactive elements." |
| 1952 |
msgstr "" |
| 1953 |
|
| 1954 |
#: legacy/admin/partials/wpvr_checklist_template.php:96 |
| 1955 |
msgid "Enable basic controls" |
| 1956 |
msgstr "" |
| 1957 |
|
| 1958 |
#: legacy/admin/partials/wpvr_checklist_template.php:107 |
| 1959 |
msgid "Allow movement within the tour." |
| 1960 |
msgstr "" |
| 1961 |
|
| 1962 |
#: legacy/admin/partials/wpvr_checklist_template.php:116 |
| 1963 |
#, fuzzy |
| 1964 |
msgid "Enable zoom controls" |
| 1965 |
msgstr "Wł� |
| 1966 |
cz lub wył� |
| 1967 |
cz kontrolę zoomu myszy." |
| 1968 |
|
| 1969 |
#: legacy/admin/partials/wpvr_checklist_template.php:127 |
| 1970 |
msgid "Allow zooming within the tour." |
| 1971 |
msgstr "" |
| 1972 |
|
| 1973 |
#: legacy/admin/partials/wpvr_checklist_template.php:137 |
| 1974 |
#, fuzzy |
| 1975 |
msgid "Publish the tour" |
| 1976 |
msgstr "Opublikuj swoj� |
| 1977 |
wycieczkę" |
| 1978 |
|
| 1979 |
#: legacy/admin/partials/wpvr_checklist_template.php:148 |
| 1980 |
msgid "Publish your tour and embed it anywhere on your site." |
| 1981 |
msgstr "" |
| 1982 |
|
| 1983 |
#: legacy/admin/partials/wpvr_confirmation_alert.php:426 |
| 1984 |
#, fuzzy |
| 1985 |
msgid "Layout Settings" |
| 1986 |
msgstr "Ustawienie" |
| 1987 |
|
| 1988 |
#: legacy/admin/partials/wpvr_confirmation_alert.php:431 |
| 1989 |
#, fuzzy |
| 1990 |
msgid "Icon background Color:" |
| 1991 |
msgstr "Kolor tła" |
| 1992 |
|
| 1993 |
#: legacy/admin/partials/wpvr_confirmation_alert.php:441 |
| 1994 |
#, fuzzy |
| 1995 |
msgid "Icon Color:" |
| 1996 |
msgstr "Kolor tła" |
| 1997 |
|
| 1998 |
#: legacy/admin/partials/wpvr_confirmation_alert.php:452 |
| 1999 |
#, fuzzy |
| 2000 |
msgid "Apply Style" |
| 2001 |
msgstr "wskazówka zegar" |
| 2002 |
|
| 2003 |
#: legacy/admin/partials/wpvr_documentation.php:33 |
| 2004 |
msgid "Unlimited Scenes (Up to 5 in Free)" |
| 2005 |
msgstr "Nieograniczone sceny (do 5 w darmowym)" |
| 2006 |
|
| 2007 |
#: legacy/admin/partials/wpvr_documentation.php:34 |
| 2008 |
msgid "Unlimited Hotspots (Up to to 5 for a scene in free)" |
| 2009 |
msgstr "Nieograniczone hotspoty (do 5 za scenę za darmo)" |
| 2010 |
|
| 2011 |
#: legacy/admin/partials/wpvr_documentation.php:35 |
| 2012 |
msgid "Publish Tours Anywhere (Embed Add-on)" |
| 2013 |
msgstr "Publikuj wycieczki w dowolnym miejscu (dodatk do osadzenia)" |
| 2014 |
|
| 2015 |
#: legacy/admin/partials/wpvr_documentation.php:36 |
| 2016 |
msgid "WooCommerce Add-on" |
| 2017 |
msgstr "Dodatek WooCommerce" |
| 2018 |
|
| 2019 |
#: legacy/admin/partials/wpvr_documentation.php:37 |
| 2020 |
msgid "Gyroscope Support" |
| 2021 |
msgstr "Wsparcie żyroskopu" |
| 2022 |
|
| 2023 |
#: legacy/admin/partials/wpvr_documentation.php:38 |
| 2024 |
msgid "Panorama Scene Gallery" |
| 2025 |
msgstr "Galeria scen panoramicznych" |
| 2026 |
|
| 2027 |
#: legacy/admin/partials/wpvr_documentation.php:39 |
| 2028 |
msgid "Explainer Video" |
| 2029 |
msgstr "Wyjaśnienie wideo" |
| 2030 |
|
| 2031 |
#: legacy/admin/partials/wpvr_documentation.php:40 |
| 2032 |
msgid "Tour Background Audio" |
| 2033 |
msgstr "Wycieczka dźwięk w tle" |
| 2034 |
|
| 2035 |
#: legacy/admin/partials/wpvr_documentation.php:41 |
| 2036 |
msgid "Info-type Hotspots (Heading, Image, Text, Video, Gif, Links)" |
| 2037 |
msgstr "Hotspoty typu info (nagłówek, obraz, tekst, wideo, GIF, linki)" |
| 2038 |
|
| 2039 |
#: legacy/admin/partials/wpvr_documentation.php:42 |
| 2040 |
msgid "Scene-type Hotspots (Connect Panoramas)" |
| 2041 |
msgstr "Hotspoty typu sceny (Poł� |
| 2042 |
cz panoramy)" |
| 2043 |
|
| 2044 |
#: legacy/admin/partials/wpvr_documentation.php:43 |
| 2045 |
msgid "Custom Icon & Color for Hotspots (Using CSS)" |
| 2046 |
msgstr "Niestandardowa ikona i kolor dla hotspotów (przy użyciu CSS)" |
| 2047 |
|
| 2048 |
#: legacy/admin/partials/wpvr_documentation.php:44 |
| 2049 |
msgid "900+ Icons & RGB Color Support for Hotspots" |
| 2050 |
msgstr "900+ ikon i obsługa kolorów RGB dla hotspotów" |
| 2051 |
|
| 2052 |
#: legacy/admin/partials/wpvr_documentation.php:45 |
| 2053 |
msgid "Partial Panorama / Mobile Panorama Support" |
| 2054 |
msgstr "Częściowa Panorama / Mobilna Panorama Wsparcie" |
| 2055 |
|
| 2056 |
#: legacy/admin/partials/wpvr_documentation.php:46 |
| 2057 |
msgid "360 Video Support" |
| 2058 |
msgstr "Wsparcie wideo 360" |
| 2059 |
|
| 2060 |
#: legacy/admin/partials/wpvr_documentation.php:47 |
| 2061 |
msgid "Google Street View" |
| 2062 |
msgstr "Widok ulicy Google" |
| 2063 |
|
| 2064 |
#: legacy/admin/partials/wpvr_documentation.php:48 |
| 2065 |
msgid "Cubemap Image Support" |
| 2066 |
msgstr "Obsługa obrazów CubeMap" |
| 2067 |
|
| 2068 |
#: legacy/admin/partials/wpvr_documentation.php:49 |
| 2069 |
msgid "VR Glass Support for Video Tours" |
| 2070 |
msgstr "Wsparcie VR Glass dla wideour wycieczek" |
| 2071 |
|
| 2072 |
#: legacy/admin/partials/wpvr_documentation.php:50 |
| 2073 |
msgid "Fluent Forms Add-on" |
| 2074 |
msgstr "Dodatek Fluent Forms" |
| 2075 |
|
| 2076 |
#: legacy/admin/partials/wpvr_documentation.php:51 |
| 2077 |
msgid "Autoload Tours" |
| 2078 |
msgstr "Wycieczki z automatycznym ładowaniem" |
| 2079 |
|
| 2080 |
#: legacy/admin/partials/wpvr_documentation.php:52 |
| 2081 |
msgid "Custom Rotation Settings" |
| 2082 |
msgstr "Niestandardowe ustawienia rotacji" |
| 2083 |
|
| 2084 |
#: legacy/admin/partials/wpvr_documentation.php:53 |
| 2085 |
msgid "Full Page Virtual Tours" |
| 2086 |
msgstr "Wirtualne wycieczki na całej stronie" |
| 2087 |
|
| 2088 |
#: legacy/admin/partials/wpvr_documentation.php:54 |
| 2089 |
msgid "Custom Preview Image & Text" |
| 2090 |
msgstr "Niestandardowy obraz podgl� |
| 2091 |
du i tekst" |
| 2092 |
|
| 2093 |
#: legacy/admin/partials/wpvr_documentation.php:55 |
| 2094 |
msgid "Company Logo & Description" |
| 2095 |
msgstr "Logo firmy i opis" |
| 2096 |
|
| 2097 |
#: legacy/admin/partials/wpvr_documentation.php:56 |
| 2098 |
msgid "Import & Export Virtual Tours" |
| 2099 |
msgstr "Import i eksport wirtualne wycieczki" |
| 2100 |
|
| 2101 |
#: legacy/admin/partials/wpvr_documentation.php:57 |
| 2102 |
msgid "Duplicate Tours with One Click" |
| 2103 |
msgstr "Powiel wycieczki za jednym kliknięciem" |
| 2104 |
|
| 2105 |
#: legacy/admin/partials/wpvr_documentation.php:58 |
| 2106 |
msgid "Control Horizontal & Vertical View of Panorama Images" |
| 2107 |
msgstr "Kontroluj poziomy i pionowy widok obrazów panoramicznych" |
| 2108 |
|
| 2109 |
#: legacy/admin/partials/wpvr_documentation.php:59 |
| 2110 |
msgid "Custom Zoom Settings" |
| 2111 |
msgstr "Niestandardowe ustawienia powiększenia" |
| 2112 |
|
| 2113 |
#: legacy/admin/partials/wpvr_documentation.php:60 |
| 2114 |
msgid "Custom Panorama Loading Face" |
| 2115 |
msgstr "Niestandardowa twarz ładuj� |
| 2116 |
ca panoramę" |
| 2117 |
|
| 2118 |
#: legacy/admin/partials/wpvr_documentation.php:61 |
| 2119 |
msgid "Background Panoramas" |
| 2120 |
msgstr "Panoramy w tle" |
| 2121 |
|
| 2122 |
#: legacy/admin/partials/wpvr_documentation.php:62 |
| 2123 |
msgid "Home Button to visit Default Scene" |
| 2124 |
msgstr "Przycisk Home, aby odwiedzić domyśln� |
| 2125 |
scenę" |
| 2126 |
|
| 2127 |
#: legacy/admin/partials/wpvr_documentation.php:63 |
| 2128 |
msgid "Scene Title" |
| 2129 |
msgstr "Tytuł sceny" |
| 2130 |
|
| 2131 |
#: legacy/admin/partials/wpvr_documentation.php:64 |
| 2132 |
msgid "Scene Author with URL" |
| 2133 |
msgstr "Autor sceny z adresem URL" |
| 2134 |
|
| 2135 |
#: legacy/admin/partials/wpvr_documentation.php:65 |
| 2136 |
msgid "Enable or Disable Keyboard Movement Control." |
| 2137 |
msgstr "Wł� |
| 2138 |
cz lub wył� |
| 2139 |
cz kontrolę ruchu klawiatury." |
| 2140 |
|
| 2141 |
#: legacy/admin/partials/wpvr_documentation.php:66 |
| 2142 |
msgid "Enable or Disable Keyboard Zoom Control." |
| 2143 |
msgstr "Wł� |
| 2144 |
cz lub wył� |
| 2145 |
cz kontrolę zoomu klawiatury." |
| 2146 |
|
| 2147 |
#: legacy/admin/partials/wpvr_documentation.php:67 |
| 2148 |
msgid "Enable or Disable Mouse Drag Control." |
| 2149 |
msgstr "Wł� |
| 2150 |
cz lub wył� |
| 2151 |
cz kontrolę przeci� |
| 2152 |
gania myszy." |
| 2153 |
|
| 2154 |
#: legacy/admin/partials/wpvr_documentation.php:68 |
| 2155 |
msgid "Enable or Disable Mouse Zoom control." |
| 2156 |
msgstr "Wł� |
| 2157 |
cz lub wył� |
| 2158 |
cz kontrolę zoomu myszy." |
| 2159 |
|
| 2160 |
#: legacy/admin/partials/wpvr_documentation.php:69 |
| 2161 |
msgid "Mouse Control." |
| 2162 |
msgstr "Kontrola myszy." |
| 2163 |
|
| 2164 |
#: legacy/admin/partials/wpvr_documentation.php:70 |
| 2165 |
msgid "On Screen Compass." |
| 2166 |
msgstr "Kompas na ekranie." |
| 2167 |
|
| 2168 |
#: legacy/admin/partials/wpvr_documentation.php:71 |
| 2169 |
msgid "Scene Titles on Gallery." |
| 2170 |
msgstr "Tytuły scen w galerii." |
| 2171 |
|
| 2172 |
#: legacy/admin/partials/wpvr_documentation.php:72 |
| 2173 |
msgid "Customize Icon & Logo of Control Buttons." |
| 2174 |
msgstr "Dostosuj ikonę i logo przycisków sterowania." |
| 2175 |
|
| 2176 |
#: legacy/admin/partials/wpvr_documentation.php:73 |
| 2177 |
msgid "Autoload & Autoplay Video Tours." |
| 2178 |
msgstr "Automatyczne ładowanie i autoodtwarzanie wideo." |
| 2179 |
|
| 2180 |
#: legacy/admin/partials/wpvr_documentation.php:93 |
| 2181 |
msgid "features" |
| 2182 |
msgstr "zarzut" |
| 2183 |
|
| 2184 |
#: legacy/admin/partials/wpvr_documentation.php:94 |
| 2185 |
msgid "free" |
| 2186 |
msgstr "bezpłatny" |
| 2187 |
|
| 2188 |
#: legacy/admin/partials/wpvr_documentation.php:115 |
| 2189 |
#: legacy/admin/partials/wpvr_documentation.php:116 wpvr.php:426 |
| 2190 |
msgid "Upgrade to Pro" |
| 2191 |
msgstr "Uaktualnij do Pro" |
| 2192 |
|
| 2193 |
#: legacy/admin/partials/wpvr_license.php:18 |
| 2194 |
msgid "License Key" |
| 2195 |
msgstr "klucz licencyjny" |
| 2196 |
|
| 2197 |
#: legacy/admin/partials/wpvr_license.php:22 |
| 2198 |
msgid "Enter your license key, save changes and activate." |
| 2199 |
msgstr "Wprowadź klucz licencyjny, zapisz zmiany i aktywuj." |
| 2200 |
|
| 2201 |
#: legacy/admin/partials/wpvr_license.php:28 |
| 2202 |
#: legacy/admin/partials/wpvr_license.php:38 |
| 2203 |
msgid "Activate License" |
| 2204 |
msgstr "Aktywuj licencję" |
| 2205 |
|
| 2206 |
#: legacy/admin/partials/wpvr_license.php:32 |
| 2207 |
msgid "Active" |
| 2208 |
msgstr "" |
| 2209 |
|
| 2210 |
#: legacy/admin/partials/wpvr_license.php:34 |
| 2211 |
msgid "Deactivate License" |
| 2212 |
msgstr "Dezaktywuj licencję" |
| 2213 |
|
| 2214 |
#: legacy/admin/partials/wpvr_setting.php:97 |
| 2215 |
#: legacy/admin/partials/wpvr_setting.php:104 |
| 2216 |
#, fuzzy |
| 2217 |
msgid "General Settings" |
| 2218 |
msgstr "Ogólne opcje konfiguracji" |
| 2219 |
|
| 2220 |
#: legacy/admin/partials/wpvr_setting.php:106 |
| 2221 |
#, fuzzy |
| 2222 |
msgid "Setup Options" |
| 2223 |
msgstr "Ogólne opcje konfiguracji" |
| 2224 |
|
| 2225 |
#: legacy/admin/partials/wpvr_setting.php:131 |
| 2226 |
msgid "" |
| 2227 |
"Allow the Editors of your site to Create, Edit, Update, and Delete virtual " |
| 2228 |
"tours (They can access other users' tours):" |
| 2229 |
msgstr "" |
| 2230 |
"Zezwól redaktorom Twojej witryny na tworzenie, edycję, aktualizację i " |
| 2231 |
"usuwanie wirtualnych wycieczek (mog� |
| 2232 |
uzyskać dostęp do wycieczek innych " |
| 2233 |
"użytkowników):" |
| 2234 |
|
| 2235 |
#. translators: %s: documentation url |
| 2236 |
#: legacy/admin/partials/wpvr_setting.php:159 |
| 2237 |
#, php-format |
| 2238 |
msgid "" |
| 2239 |
"Enable editors to manage all virtual tours on your site, including those " |
| 2240 |
"created by other users. <a href=\"%s\" target=\"_blank\" rel=\"noopener " |
| 2241 |
"noreferrer\">View Doc</a>" |
| 2242 |
msgstr "" |
| 2243 |
|
| 2244 |
#: legacy/admin/partials/wpvr_setting.php:174 |
| 2245 |
msgid "" |
| 2246 |
"Allow the Authors of your site to Create, Edit, Update, and Delete virtual " |
| 2247 |
"tours (They can access their own tours only):" |
| 2248 |
msgstr "" |
| 2249 |
"Zezwól autorom Twojej witryny na tworzenie, edycję, aktualizację i usuwanie " |
| 2250 |
"wirtualnych wycieczek (mog� |
| 2251 |
uzyskać dostęp tylko do własnych wycieczek):" |
| 2252 |
|
| 2253 |
#. translators: %s: documentation url |
| 2254 |
#: legacy/admin/partials/wpvr_setting.php:201 |
| 2255 |
#, php-format |
| 2256 |
msgid "" |
| 2257 |
"Grant authors permission to manage only their own virtual tours without " |
| 2258 |
"accessing others' tours. <a href=\"%s\" target=\"_blank\" rel=\"noopener " |
| 2259 |
"noreferrer\">View Doc</a>" |
| 2260 |
msgstr "" |
| 2261 |
|
| 2262 |
#: legacy/admin/partials/wpvr_setting.php:216 |
| 2263 |
#, fuzzy |
| 2264 |
msgid "" |
| 2265 |
"Allow Dokan Vendors of your site to Create, Edit, Update, and Delete virtual " |
| 2266 |
"tours (They can access their own tours only):" |
| 2267 |
msgstr "" |
| 2268 |
"Zezwól autorom Twojej witryny na tworzenie, edycję, aktualizację i usuwanie " |
| 2269 |
"wirtualnych wycieczek (mog� |
| 2270 |
uzyskać dostęp tylko do własnych wycieczek):" |
| 2271 |
|
| 2272 |
#: legacy/admin/partials/wpvr_setting.php:238 |
| 2273 |
#, fuzzy |
| 2274 |
msgid "" |
| 2275 |
"Dokan vendor will be able to Create, Edit, Update, and Delete their own " |
| 2276 |
"virtual tours only." |
| 2277 |
msgstr "" |
| 2278 |
"Autorzy będ� |
| 2279 |
mogli tworzyć, edytować, aktualizować i usuwać tylko własne " |
| 2280 |
"wirtualne wycieczki." |
| 2281 |
|
| 2282 |
#: legacy/admin/partials/wpvr_setting.php:246 |
| 2283 |
msgid "Disable Fontawesome from WP VR:" |
| 2284 |
msgstr "Wył� |
| 2285 |
cz FontaWesome z WP VR:" |
| 2286 |
|
| 2287 |
#. translators: %s: documentation url |
| 2288 |
#: legacy/admin/partials/wpvr_setting.php:274 |
| 2289 |
#, php-format |
| 2290 |
msgid "" |
| 2291 |
"Turn off the Fontawesome icon library in WP VR if you prefer to use custom " |
| 2292 |
"icons or other icon libraries. <a href=\"%s\" target=\"_blank\" rel=" |
| 2293 |
"\"noopener noreferrer\">View Doc</a>" |
| 2294 |
msgstr "" |
| 2295 |
|
| 2296 |
#: legacy/admin/partials/wpvr_setting.php:288 |
| 2297 |
msgid "Enable mobile media resizer:" |
| 2298 |
msgstr "Wł� |
| 2299 |
cz zmianę rozmiaru nośników mobilnych:" |
| 2300 |
|
| 2301 |
#: legacy/admin/partials/wpvr_setting.php:310 |
| 2302 |
msgid "" |
| 2303 |
" Automatically adjust media sizes for mobile devices to ensure optimal " |
| 2304 |
"viewing performance." |
| 2305 |
msgstr "" |
| 2306 |
|
| 2307 |
#: legacy/admin/partials/wpvr_setting.php:316 |
| 2308 |
msgid "Disable WordPress Large Image Handler on WP VR:" |
| 2309 |
msgstr "Wył� |
| 2310 |
cz duży program obsługi obrazów WordPress na WP VR:" |
| 2311 |
|
| 2312 |
#. translators: %s: documentation url |
| 2313 |
#: legacy/admin/partials/wpvr_setting.php:344 |
| 2314 |
#, php-format |
| 2315 |
msgid "" |
| 2316 |
"Prevent WordPress from resizing large images, keeping the original size for " |
| 2317 |
"better quality in tours. <a href=\"%s\" target=\"_blank\" rel=\"noopener " |
| 2318 |
"noreferrer\">View Doc</a>" |
| 2319 |
msgstr "" |
| 2320 |
|
| 2321 |
#: legacy/admin/partials/wpvr_setting.php:360 |
| 2322 |
msgid "Disable On Hover Content for Mobile:" |
| 2323 |
msgstr "Wył� |
| 2324 |
cz zawartość najechania na telefon komórkowy:" |
| 2325 |
|
| 2326 |
#. translators: %s: documentation url |
| 2327 |
#: legacy/admin/partials/wpvr_setting.php:388 |
| 2328 |
#, php-format |
| 2329 |
msgid "" |
| 2330 |
"Turn off hover-based content interactions on mobile devices to enhance " |
| 2331 |
"usability on touch screens. <a href=\"%s\" target=\"_blank\" rel=\"noopener " |
| 2332 |
"noreferrer\">View Doc</a>" |
| 2333 |
msgstr "" |
| 2334 |
|
| 2335 |
#: legacy/admin/partials/wpvr_setting.php:402 |
| 2336 |
msgid "Enable Mobile Hotspot Tip:" |
| 2337 |
msgstr "" |
| 2338 |
|
| 2339 |
#: legacy/admin/partials/wpvr_setting.php:415 |
| 2340 |
msgid "" |
| 2341 |
"When enabled, a tip message is shown to mobile visitors after their first " |
| 2342 |
"interaction with the virtual tour." |
| 2343 |
msgstr "" |
| 2344 |
|
| 2345 |
#: legacy/admin/partials/wpvr_setting.php:421 |
| 2346 |
msgid "" |
| 2347 |
"Enable script control (It will load the WP VR scripts on the pages with " |
| 2348 |
"virtual tours only):" |
| 2349 |
msgstr "" |
| 2350 |
"Wł� |
| 2351 |
cz kontrolę skryptów (załaduje skrypty WP VR na stronach tylko z " |
| 2352 |
"wirtualnymi wycieczkami):" |
| 2353 |
|
| 2354 |
#. translators: %s: documentation url |
| 2355 |
#: legacy/admin/partials/wpvr_setting.php:449 |
| 2356 |
#, php-format |
| 2357 |
msgid "" |
| 2358 |
"Load WP VR scripts only on pages with virtual tours, improving page load " |
| 2359 |
"times on other pages. <a href=\"%s\" target=\"_blank\" rel=\"noopener " |
| 2360 |
"noreferrer\">View Doc</a>" |
| 2361 |
msgstr "" |
| 2362 |
|
| 2363 |
#: legacy/admin/partials/wpvr_setting.php:463 |
| 2364 |
msgid "" |
| 2365 |
"List of allowed pages to load WP VR scripts (The URLs of the pages on your " |
| 2366 |
"site with virtual tours):" |
| 2367 |
msgstr "" |
| 2368 |
"Lista dozwolonych stron do załadowania skryptów WP VR (adresy URL stron w " |
| 2369 |
"Twojej witrynie z wirtualnymi wycieczkami):" |
| 2370 |
|
| 2371 |
#: legacy/admin/partials/wpvr_setting.php:468 |
| 2372 |
msgid "" |
| 2373 |
"List the pages with virtual tours like this: https://example.com/tour1/, " |
| 2374 |
"https://example.com/tour2/" |
| 2375 |
msgstr "" |
| 2376 |
"Wymień strony z wirtualnymi wycieczkami w następuj� |
| 2377 |
cy sposób: https://" |
| 2378 |
"example.com/tour1/, https://example.com/tour2/" |
| 2379 |
|
| 2380 |
#: legacy/admin/partials/wpvr_setting.php:475 |
| 2381 |
#, fuzzy |
| 2382 |
msgid "" |
| 2383 |
"Video Tour JS control (It will load the WP VR Video JS library in the listed " |
| 2384 |
"pages only):" |
| 2385 |
msgstr "" |
| 2386 |
"Wł� |
| 2387 |
cz kontrolę wideo JS (załaduje bibliotekę WP VR Video JS tylko na " |
| 2388 |
"wymienionych stronach):" |
| 2389 |
|
| 2390 |
#. translators: %s: documentation url |
| 2391 |
#: legacy/admin/partials/wpvr_setting.php:503 |
| 2392 |
#, php-format |
| 2393 |
msgid "" |
| 2394 |
"Activate the Video.js library only on pages that contain virtual video " |
| 2395 |
"tours, optimizing resources. <a href=\"%s\" target=\"_blank\" rel=\"noopener " |
| 2396 |
"noreferrer\">View Doc</a>" |
| 2397 |
msgstr "" |
| 2398 |
|
| 2399 |
#: legacy/admin/partials/wpvr_setting.php:517 |
| 2400 |
msgid "" |
| 2401 |
"List of allowed pages to load WP VR Video JS library (The URLs of the pages " |
| 2402 |
"on your site, You want to load Video JS):" |
| 2403 |
msgstr "" |
| 2404 |
"Lista dozwolonych stron do załadowania biblioteki WP VR Video JS (adresy URL " |
| 2405 |
"stron w Twojej witrynie, chcesz załadować wideo JS):" |
| 2406 |
|
| 2407 |
#: legacy/admin/partials/wpvr_setting.php:522 |
| 2408 |
msgid "" |
| 2409 |
"List the pages like this: https://example.com/tour1/, https://example.com/" |
| 2410 |
"tour2/" |
| 2411 |
msgstr "" |
| 2412 |
"Wymień strony w następuj� |
| 2413 |
cy sposób: https://example.com/tour1/, https://" |
| 2414 |
"example.com/tour2/" |
| 2415 |
|
| 2416 |
#: legacy/admin/partials/wpvr_setting.php:535 |
| 2417 |
msgid "Flip the phone to landscape mode for a better experience of the tour." |
| 2418 |
msgstr "Przesuń telefon w tryb poziomy, aby uzyskać lepsze wrażenia z trasy." |
| 2419 |
|
| 2420 |
#: legacy/admin/partials/wpvr_setting.php:539 |
| 2421 |
msgid "Front-End Notice for Mobile Visitors:" |
| 2422 |
msgstr "Powiadomienie z front-end dla użytkowników mobilnych:" |
| 2423 |
|
| 2424 |
#: legacy/admin/partials/wpvr_setting.php:561 |
| 2425 |
msgid "" |
| 2426 |
"Display a message on the front end to inform mobile visitors about virtual " |
| 2427 |
"tour capabilities or requirements." |
| 2428 |
msgstr "" |
| 2429 |
|
| 2430 |
#: legacy/admin/partials/wpvr_setting.php:569 |
| 2431 |
msgid "VR GLass Support:" |
| 2432 |
msgstr "Wsparcie szkła VR:" |
| 2433 |
|
| 2434 |
#. translators: %s: documentation url |
| 2435 |
#: legacy/admin/partials/wpvr_setting.php:607 |
| 2436 |
#, php-format |
| 2437 |
msgid "" |
| 2438 |
"Enable compatibility with VR glasses for immersive viewing of virtual tours " |
| 2439 |
"on supported devices. <a href=\"%s\" target=\"_blank\" rel=\"noopener " |
| 2440 |
"noreferrer\">View Doc</a>" |
| 2441 |
msgstr "" |
| 2442 |
|
| 2443 |
#: legacy/admin/partials/wpvr_setting.php:621 |
| 2444 |
#, fuzzy |
| 2445 |
msgid "Convert any jpeg or png format image to WebP on media upload:" |
| 2446 |
msgstr "" |
| 2447 |
"Konwertuj dowolny obraz w formacie JPEG lub PNG na WebP podczas przesyłania " |
| 2448 |
"multimediów:" |
| 2449 |
|
| 2450 |
#: legacy/admin/partials/wpvr_setting.php:657 |
| 2451 |
msgid "" |
| 2452 |
"Automatically convert JPEG or PNG images to the WebP format when uploading, " |
| 2453 |
"improving load times and image quality." |
| 2454 |
msgstr "" |
| 2455 |
|
| 2456 |
#: legacy/admin/partials/wpvr_setting.php:666 |
| 2457 |
msgid "Allow Usage Data Sharing:" |
| 2458 |
msgstr "" |
| 2459 |
|
| 2460 |
#: legacy/admin/partials/wpvr_setting.php:678 |
| 2461 |
msgid "" |
| 2462 |
"Share your site URL, email, and anonymous usage data to help us improve WP " |
| 2463 |
"VR. You can disable this at any time." |
| 2464 |
msgstr "" |
| 2465 |
|
| 2466 |
#: legacy/admin/partials/wpvr_setting.php:686 |
| 2467 |
msgid "Select a Version to Rollback" |
| 2468 |
msgstr "Wybierz wersję do wycofania" |
| 2469 |
|
| 2470 |
#: legacy/admin/partials/wpvr_setting.php:708 |
| 2471 |
msgid "Succesfully Saved" |
| 2472 |
msgstr "" |
| 2473 |
|
| 2474 |
#: legacy/admin/partials/wpvr_setting.php:712 |
| 2475 |
#, fuzzy |
| 2476 |
msgid "Reset Defaults" |
| 2477 |
msgstr "Ustaw jako domyślny" |
| 2478 |
|
| 2479 |
#: legacy/admin/partials/wpvr_setting.php:716 |
| 2480 |
#, fuzzy |
| 2481 |
msgid "Save Settings" |
| 2482 |
msgstr "Ustawienie sceny" |
| 2483 |
|
| 2484 |
#: legacy/bricks/bricks.php:65 legacy/bricks/Wpvr-widget.php:76 |
| 2485 |
#: legacy/bricks/Wpvr-widget.php:90 legacy/bricks/Wpvr-widget.php:96 |
| 2486 |
#: legacy/builders/wpbakery/wpvr-element.php:44 |
| 2487 |
#: legacy/elementor/elements/Wpvr-widget.php:43 |
| 2488 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:60 |
| 2489 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:66 |
| 2490 |
msgid "WPVR" |
| 2491 |
msgstr "WPVR" |
| 2492 |
|
| 2493 |
#: legacy/bricks/Wpvr-widget.php:130 |
| 2494 |
#: legacy/builders/wpbakery/wpvr-element.php:53 |
| 2495 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:128 |
| 2496 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:51 legacy/src/index.js:134 |
| 2497 |
#, fuzzy |
| 2498 |
msgid "Select Tour" |
| 2499 |
msgstr "Wybierz swój formularz" |
| 2500 |
|
| 2501 |
#: legacy/bricks/Wpvr-widget.php:140 |
| 2502 |
#, fuzzy |
| 2503 |
msgid "Width(px)" |
| 2504 |
msgstr "Szerokość (Px)" |
| 2505 |
|
| 2506 |
#: legacy/bricks/Wpvr-widget.php:144 |
| 2507 |
#, fuzzy |
| 2508 |
msgid "Height(px)" |
| 2509 |
msgstr "zenit" |
| 2510 |
|
| 2511 |
#: legacy/bricks/Wpvr-widget.php:148 |
| 2512 |
#, fuzzy |
| 2513 |
msgid "Radius(px)" |
| 2514 |
msgstr "promień" |
| 2515 |
|
| 2516 |
#: legacy/bricks/Wpvr-widget.php:194 |
| 2517 |
msgid "No tour has been selected." |
| 2518 |
msgstr "" |
| 2519 |
|
| 2520 |
#: legacy/builders/wpbakery/wpvr-element.php:26 |
| 2521 |
#, fuzzy |
| 2522 |
msgid "Select a tour" |
| 2523 |
msgstr "Wybierz swój formularz" |
| 2524 |
|
| 2525 |
#: legacy/builders/wpbakery/wpvr-element.php:42 |
| 2526 |
#, fuzzy |
| 2527 |
msgid "WPVR - Virtual Tour" |
| 2528 |
msgstr "Wirtualne wycieczki na całej stronie" |
| 2529 |
|
| 2530 |
#: legacy/builders/wpbakery/wpvr-element.php:46 |
| 2531 |
msgid "Embed a WPVR virtual tour with full analytics and tracking support." |
| 2532 |
msgstr "" |
| 2533 |
|
| 2534 |
#: legacy/builders/wpbakery/wpvr-element.php:62 |
| 2535 |
msgid "Width (number only)" |
| 2536 |
msgstr "" |
| 2537 |
|
| 2538 |
#: legacy/builders/wpbakery/wpvr-element.php:70 |
| 2539 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:152 |
| 2540 |
msgid "Width Unit" |
| 2541 |
msgstr "Szerokość Jednostka" |
| 2542 |
|
| 2543 |
#: legacy/builders/wpbakery/wpvr-element.php:84 |
| 2544 |
msgid "Height (number only)" |
| 2545 |
msgstr "" |
| 2546 |
|
| 2547 |
#: legacy/builders/wpbakery/wpvr-element.php:92 |
| 2548 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:193 |
| 2549 |
msgid "Height Unit" |
| 2550 |
msgstr "Wysokość" |
| 2551 |
|
| 2552 |
#: legacy/builders/wpbakery/wpvr-element.php:104 |
| 2553 |
#, fuzzy |
| 2554 |
msgid "Mobile Height (number only)" |
| 2555 |
msgstr "Mobilna jednostka wysokości" |
| 2556 |
|
| 2557 |
#: legacy/builders/wpbakery/wpvr-element.php:112 |
| 2558 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:215 |
| 2559 |
msgid "Mobile Height Unit" |
| 2560 |
msgstr "Mobilna jednostka wysokości" |
| 2561 |
|
| 2562 |
#: legacy/elementor/elements/Wpvr-widget.php:145 |
| 2563 |
msgid "WPVR Setup" |
| 2564 |
msgstr "Konfiguracja WPVR" |
| 2565 |
|
| 2566 |
#: legacy/elementor/elements/Wpvr-widget.php:156 |
| 2567 |
#, fuzzy |
| 2568 |
msgid "Select Tour:" |
| 2569 |
msgstr "Wybierz swój formularz" |
| 2570 |
|
| 2571 |
#: legacy/elementor/elements/Wpvr-widget.php:165 |
| 2572 |
msgid "Width:" |
| 2573 |
msgstr "Szerokość:" |
| 2574 |
|
| 2575 |
#: legacy/elementor/elements/Wpvr-widget.php:168 |
| 2576 |
#: legacy/elementor/elements/Wpvr-widget.php:178 |
| 2577 |
#: legacy/elementor/elements/Wpvr-widget.php:188 |
| 2578 |
#: legacy/elementor/elements/Wpvr-widget.php:197 |
| 2579 |
#, fuzzy |
| 2580 |
msgid "Put value in PX" |
| 2581 |
msgstr "Wpisz wartość w (px)" |
| 2582 |
|
| 2583 |
#: legacy/elementor/elements/Wpvr-widget.php:175 |
| 2584 |
msgid "Height:" |
| 2585 |
msgstr "Wysokość:" |
| 2586 |
|
| 2587 |
#: legacy/elementor/elements/Wpvr-widget.php:185 |
| 2588 |
msgid "Radius:" |
| 2589 |
msgstr "Promień:" |
| 2590 |
|
| 2591 |
#: legacy/elementor/elements/Wpvr-widget.php:195 legacy/src/index.js:240 |
| 2592 |
msgid "Mobile Height" |
| 2593 |
msgstr "Wysokość mobilna" |
| 2594 |
|
| 2595 |
#: legacy/includes/class-wpvr-linno-telemetry.php:480 |
| 2596 |
msgid "Setup / Interface is too complex" |
| 2597 |
msgstr "" |
| 2598 |
|
| 2599 |
#: legacy/includes/class-wpvr-linno-telemetry.php:481 |
| 2600 |
msgid "What was the biggest blocker?" |
| 2601 |
msgstr "" |
| 2602 |
|
| 2603 |
#: legacy/includes/class-wpvr-linno-telemetry.php:486 |
| 2604 |
msgid "Missing specific VR feature" |
| 2605 |
msgstr "" |
| 2606 |
|
| 2607 |
#: legacy/includes/class-wpvr-linno-telemetry.php:487 |
| 2608 |
msgid "Which feature? (Floor Plan, WebVR, etc.)" |
| 2609 |
msgstr "" |
| 2610 |
|
| 2611 |
#: legacy/includes/class-wpvr-linno-telemetry.php:492 |
| 2612 |
msgid "Tour not displaying / Error" |
| 2613 |
msgstr "" |
| 2614 |
|
| 2615 |
#: legacy/includes/class-wpvr-linno-telemetry.php:493 |
| 2616 |
msgid "Any error message or URL?" |
| 2617 |
msgstr "" |
| 2618 |
|
| 2619 |
#: legacy/includes/class-wpvr-linno-telemetry.php:498 |
| 2620 |
msgid "Image quality / Performance issues" |
| 2621 |
msgstr "" |
| 2622 |
|
| 2623 |
#: legacy/includes/class-wpvr-linno-telemetry.php:499 |
| 2624 |
msgid "Image size or browser details help." |
| 2625 |
msgstr "" |
| 2626 |
|
| 2627 |
#: legacy/includes/class-wpvr-linno-telemetry.php:504 |
| 2628 |
msgid "Found a better solution" |
| 2629 |
msgstr "" |
| 2630 |
|
| 2631 |
#: legacy/includes/class-wpvr-linno-telemetry.php:505 |
| 2632 |
msgid "Which tool? What did it do better?" |
| 2633 |
msgstr "" |
| 2634 |
|
| 2635 |
#: legacy/includes/class-wpvr-linno-telemetry.php:510 |
| 2636 |
msgid "Just testing / One-time project" |
| 2637 |
msgstr "" |
| 2638 |
|
| 2639 |
#: legacy/includes/class-wpvr-linno-telemetry.php:511 |
| 2640 |
msgid "What were you building?" |
| 2641 |
msgstr "" |
| 2642 |
|
| 2643 |
#: legacy/includes/class-wpvr.php:246 |
| 2644 |
#, fuzzy |
| 2645 |
msgid "Floor Plan Settings : " |
| 2646 |
msgstr "Ustawienia wideo:" |
| 2647 |
|
| 2648 |
#: legacy/includes/class-wpvr.php:253 |
| 2649 |
msgid "Enable Floor Plan: " |
| 2650 |
msgstr "" |
| 2651 |
|
| 2652 |
#. translators: %s: documentation url |
| 2653 |
#: legacy/includes/class-wpvr.php:268 |
| 2654 |
#, php-format |
| 2655 |
msgid "" |
| 2656 |
"Activate the floor plan view for your virtual tour. <a href=\"%s\" target=" |
| 2657 |
"\"_blank\" rel=\"noopener noreferrer\">View Doc</a>" |
| 2658 |
msgstr "" |
| 2659 |
|
| 2660 |
#: legacy/includes/class-wpvr.php:296 |
| 2661 |
#, fuzzy |
| 2662 |
msgid "Background Tour Settings : " |
| 2663 |
msgstr "Ustawienia wideo:" |
| 2664 |
|
| 2665 |
#: legacy/includes/class-wpvr.php:302 |
| 2666 |
#, fuzzy |
| 2667 |
msgid "Enable Background Tour: " |
| 2668 |
msgstr "Kolor tła" |
| 2669 |
|
| 2670 |
#. translators: %s: documentation url |
| 2671 |
#: legacy/includes/class-wpvr.php:317 |
| 2672 |
#, php-format |
| 2673 |
msgid "" |
| 2674 |
"When enabled, a title and subtitle will appear at the top of the tour. <a " |
| 2675 |
"href=\"%s\" target=\"_blank\" rel=\"noopener noreferrer\">View Doc</a>" |
| 2676 |
msgstr "" |
| 2677 |
|
| 2678 |
#: legacy/includes/class-wpvr.php:343 |
| 2679 |
#, fuzzy |
| 2680 |
msgid "Embed Google Street View : " |
| 2681 |
msgstr "Widok ulicy Google" |
| 2682 |
|
| 2683 |
#: legacy/includes/class-wpvr.php:347 |
| 2684 |
#, fuzzy |
| 2685 |
msgid "Enable Street View:" |
| 2686 |
msgstr "Widok ulicy Google" |
| 2687 |
|
| 2688 |
#: legacy/includes/class-wpvr.php:352 |
| 2689 |
msgid "Insert a Street View iframe link." |
| 2690 |
msgstr "" |
| 2691 |
|
| 2692 |
#: legacy/includes/class-wpvr.php:388 |
| 2693 |
#, fuzzy |
| 2694 |
msgid "Export Tour : " |
| 2695 |
msgstr "Importuj plik wycieczki:" |
| 2696 |
|
| 2697 |
#: legacy/includes/class-wpvr.php:389 |
| 2698 |
#, fuzzy |
| 2699 |
msgid "Download" |
| 2700 |
msgstr "pobierz kod QR" |
| 2701 |
|
| 2702 |
#: legacy/includes/setup-wizard.php:109 |
| 2703 |
msgid "Limit Reached" |
| 2704 |
msgstr "" |
| 2705 |
|
| 2706 |
#. translators: %d: maximum number of hotspots allowed in free version |
| 2707 |
#: legacy/includes/setup-wizard.php:111 |
| 2708 |
#, php-format |
| 2709 |
msgid "You can add up to %d hotspots on each scene in the Free version." |
| 2710 |
msgstr "" |
| 2711 |
|
| 2712 |
#: legacy/includes/setup-wizard.php:112 |
| 2713 |
msgid "Upgrade to Pro to add an unlimited number of hotspots." |
| 2714 |
msgstr "" |
| 2715 |
|
| 2716 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:129 |
| 2717 |
msgid "WPVR Tour ID" |
| 2718 |
msgstr "Identyfikator trasy WPVR" |
| 2719 |
|
| 2720 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:140 |
| 2721 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:59 legacy/src/index.js:141 |
| 2722 |
#, fuzzy |
| 2723 |
msgid "Tour Width" |
| 2724 |
msgstr "szerokość" |
| 2725 |
|
| 2726 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:141 |
| 2727 |
msgid "WPVR Width" |
| 2728 |
msgstr "Szerokość WPVR" |
| 2729 |
|
| 2730 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:151 |
| 2731 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:67 |
| 2732 |
#, fuzzy |
| 2733 |
msgid "Tour Width Unit" |
| 2734 |
msgstr "Szerokość Jednostka" |
| 2735 |
|
| 2736 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:155 |
| 2737 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:196 |
| 2738 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:218 |
| 2739 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:240 |
| 2740 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:71 |
| 2741 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:103 |
| 2742 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:122 |
| 2743 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:141 |
| 2744 |
msgid "px" |
| 2745 |
msgstr "ermodrale" |
| 2746 |
|
| 2747 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:156 |
| 2748 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:72 |
| 2749 |
msgid "%" |
| 2750 |
msgstr "prokuratura" |
| 2751 |
|
| 2752 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:157 |
| 2753 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:73 |
| 2754 |
msgid "vw" |
| 2755 |
msgstr "VW" |
| 2756 |
|
| 2757 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:169 |
| 2758 |
#, fuzzy |
| 2759 |
msgid "Tour Fullwidth" |
| 2760 |
msgstr "pełna szerokość" |
| 2761 |
|
| 2762 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:170 |
| 2763 |
#: legacy/src/index.js:53 |
| 2764 |
msgid "Fullwidth" |
| 2765 |
msgstr "pełna szerokość" |
| 2766 |
|
| 2767 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:184 |
| 2768 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:92 legacy/src/index.js:157 |
| 2769 |
#, fuzzy |
| 2770 |
msgid "Tour Height" |
| 2771 |
msgstr "zenit" |
| 2772 |
|
| 2773 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:185 |
| 2774 |
msgid "WPVR Height" |
| 2775 |
msgstr "Wysokość WPVR" |
| 2776 |
|
| 2777 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:192 |
| 2778 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:99 |
| 2779 |
#, fuzzy |
| 2780 |
msgid "Tour Height Unit" |
| 2781 |
msgstr "Wysokość" |
| 2782 |
|
| 2783 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:197 |
| 2784 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:104 |
| 2785 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:123 |
| 2786 |
msgid "vh" |
| 2787 |
msgstr "ves" |
| 2788 |
|
| 2789 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:206 |
| 2790 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:111 legacy/src/index.js:172 |
| 2791 |
#, fuzzy |
| 2792 |
msgid "Tour Mobile Height" |
| 2793 |
msgstr "Wysokość mobilna" |
| 2794 |
|
| 2795 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:207 |
| 2796 |
msgid "WPVR Mobile Height" |
| 2797 |
msgstr "Wysokość mobilna WPVR" |
| 2798 |
|
| 2799 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:214 |
| 2800 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:118 |
| 2801 |
#, fuzzy |
| 2802 |
msgid "Tour Mobile Height Unit" |
| 2803 |
msgstr "Mobilna jednostka wysokości" |
| 2804 |
|
| 2805 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:228 |
| 2806 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:130 |
| 2807 |
#, fuzzy |
| 2808 |
msgid "Tour Radius" |
| 2809 |
msgstr "promień" |
| 2810 |
|
| 2811 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:229 |
| 2812 |
msgid "WPVR Radius" |
| 2813 |
msgstr "Promień WPVR" |
| 2814 |
|
| 2815 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:236 |
| 2816 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:137 |
| 2817 |
#, fuzzy |
| 2818 |
msgid "Tour Radius Unit" |
| 2819 |
msgstr "Jednostka promienia" |
| 2820 |
|
| 2821 |
#: legacy/includes/wpvr-divi-modules/includes/modules/wpvr_modules/WpvrTour.php:237 |
| 2822 |
msgid "Radius Unit" |
| 2823 |
msgstr "Jednostka promienia" |
| 2824 |
|
| 2825 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:22 |
| 2826 |
#, fuzzy |
| 2827 |
msgid "WP VR Tour" |
| 2828 |
msgstr "Identyfikator trasy WPVR" |
| 2829 |
|
| 2830 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:44 |
| 2831 |
msgid "No title" |
| 2832 |
msgstr "" |
| 2833 |
|
| 2834 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:80 |
| 2835 |
#, fuzzy |
| 2836 |
msgid "Tour Width Fullwidth" |
| 2837 |
msgstr "szerokość pełna szerokość" |
| 2838 |
|
| 2839 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:84 |
| 2840 |
msgid "OFF" |
| 2841 |
msgstr "opodal" |
| 2842 |
|
| 2843 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:85 |
| 2844 |
msgid "ON" |
| 2845 |
msgstr "przez" |
| 2846 |
|
| 2847 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:114 |
| 2848 |
msgid "Height on mobile devices. Leave empty to use the main height." |
| 2849 |
msgstr "" |
| 2850 |
|
| 2851 |
#: legacy/oxygen/elements/Wpvr_Tour_Element.php:159 |
| 2852 |
msgid "Please select a WP VR Tour from the dropdown in the sidebar." |
| 2853 |
msgstr "" |
| 2854 |
|
| 2855 |
#: legacy/oxygen/WPVR_OXY_INTEGRATION.php:32 |
| 2856 |
msgid "Build with WP VR" |
| 2857 |
msgstr "" |
| 2858 |
|
| 2859 |
#: legacy/public/class-wpvr-public.php:200 |
| 2860 |
#, fuzzy |
| 2861 |
msgid "Virtual tour" |
| 2862 |
msgstr "Wirtualne wycieczki na całej stronie" |
| 2863 |
|
| 2864 |
#: legacy/public/class-wpvr-public.php:201 |
| 2865 |
msgid "" |
| 2866 |
"Use the arrow keys or W, A, S, and D to look around. Use Tab to reach tour " |
| 2867 |
"controls and hotspots." |
| 2868 |
msgstr "" |
| 2869 |
|
| 2870 |
#: legacy/public/class-wpvr-public.php:202 |
| 2871 |
#, fuzzy |
| 2872 |
msgid "Load virtual tour" |
| 2873 |
msgstr "dla nieograniczonej wirtualnej wycieczki." |
| 2874 |
|
| 2875 |
#: legacy/public/class-wpvr-public.php:203 |
| 2876 |
#, fuzzy |
| 2877 |
msgid "Tour hotspot" |
| 2878 |
msgstr "gor� |
| 2879 |
cy miejsce" |
| 2880 |
|
| 2881 |
#: legacy/public/class-wpvr-public.php:204 |
| 2882 |
msgid "View scene" |
| 2883 |
msgstr "" |
| 2884 |
|
| 2885 |
#: legacy/public/class-wpvr-public.php:205 |
| 2886 |
#, fuzzy |
| 2887 |
msgid "Scene menu" |
| 2888 |
msgstr "Typ sceny" |
| 2889 |
|
| 2890 |
#: legacy/public/class-wpvr-public.php:206 |
| 2891 |
#, fuzzy |
| 2892 |
msgid "Previous scene" |
| 2893 |
msgstr "dawny" |
| 2894 |
|
| 2895 |
#: legacy/public/class-wpvr-public.php:207 |
| 2896 |
msgid "Next scene" |
| 2897 |
msgstr "" |
| 2898 |
|
| 2899 |
#: legacy/public/class-wpvr-public.php:208 |
| 2900 |
msgid "Look up" |
| 2901 |
msgstr "" |
| 2902 |
|
| 2903 |
#: legacy/public/class-wpvr-public.php:209 |
| 2904 |
msgid "Look down" |
| 2905 |
msgstr "" |
| 2906 |
|
| 2907 |
#: legacy/public/class-wpvr-public.php:210 |
| 2908 |
msgid "Look left" |
| 2909 |
msgstr "" |
| 2910 |
|
| 2911 |
#: legacy/public/class-wpvr-public.php:211 |
| 2912 |
#, fuzzy |
| 2913 |
msgid "Look right" |
| 2914 |
msgstr "Ruszaj w prawo" |
| 2915 |
|
| 2916 |
#: legacy/public/class-wpvr-public.php:212 |
| 2917 |
#, fuzzy |
| 2918 |
msgid "Zoom in" |
| 2919 |
msgstr "pomakżyć" |
| 2920 |
|
| 2921 |
#: legacy/public/class-wpvr-public.php:213 |
| 2922 |
#, fuzzy |
| 2923 |
msgid "Zoom out" |
| 2924 |
msgstr "pomniejszyć" |
| 2925 |
|
| 2926 |
#: legacy/public/class-wpvr-public.php:214 |
| 2927 |
msgid "Toggle fullscreen" |
| 2928 |
msgstr "" |
| 2929 |
|
| 2930 |
#: legacy/public/class-wpvr-public.php:215 |
| 2931 |
msgid "Return to starting scene" |
| 2932 |
msgstr "" |
| 2933 |
|
| 2934 |
#: legacy/public/class-wpvr-public.php:216 |
| 2935 |
#, fuzzy |
| 2936 |
msgid "Toggle device orientation" |
| 2937 |
msgstr "Dekoracja tekstu" |
| 2938 |
|
| 2939 |
#: legacy/public/class-wpvr-public.php:217 |
| 2940 |
msgid "Toggle tour audio" |
| 2941 |
msgstr "" |
| 2942 |
|
| 2943 |
#: legacy/public/class-wpvr-public.php:218 |
| 2944 |
#, fuzzy |
| 2945 |
msgid "Toggle scene gallery" |
| 2946 |
msgstr "Galeria scen" |
| 2947 |
|
| 2948 |
#: legacy/public/class-wpvr-public.php:219 |
| 2949 |
msgid "Open tour video" |
| 2950 |
msgstr "" |
| 2951 |
|
| 2952 |
#: legacy/public/class-wpvr-public.php:220 |
| 2953 |
msgid "Open form" |
| 2954 |
msgstr "" |
| 2955 |
|
| 2956 |
#: legacy/public/class-wpvr-public.php:221 |
| 2957 |
msgid "Open floor plan" |
| 2958 |
msgstr "" |
| 2959 |
|
| 2960 |
#: legacy/public/class-wpvr-public.php:222 |
| 2961 |
msgid "View scene from floor plan" |
| 2962 |
msgstr "" |
| 2963 |
|
| 2964 |
#: legacy/public/class-wpvr-public.php:223 |
| 2965 |
#, fuzzy |
| 2966 |
msgid "Company information" |
| 2967 |
msgstr "Dodaj informacje o firmie" |
| 2968 |
|
| 2969 |
#: legacy/public/class-wpvr-public.php:224 |
| 2970 |
msgid "Close dialog" |
| 2971 |
msgstr "" |
| 2972 |
|
| 2973 |
#: legacy/public/class-wpvr-public.php:225 |
| 2974 |
msgid "Tour dialog" |
| 2975 |
msgstr "" |
| 2976 |
|
| 2977 |
#: legacy/public/classes/class-wpvr-shortcode.php:99 |
| 2978 |
msgid "Invalid Wpvr slug attribute" |
| 2979 |
msgstr "" |
| 2980 |
|
| 2981 |
#: legacy/public/classes/class-wpvr-shortcode.php:112 |
| 2982 |
msgid "" |
| 2983 |
"Oops! It seems that the entered tour doesn't exist. Please enter correct " |
| 2984 |
"shortcode.<br>" |
| 2985 |
msgstr "" |
| 2986 |
|
| 2987 |
#: legacy/public/classes/class-wpvr-shortcode.php:118 legacy/wpvr.php:800 |
| 2988 |
msgid "" |
| 2989 |
"Oops! It seems like this post isn't published yet. Stay tuned for updates!" |
| 2990 |
msgstr "" |
| 2991 |
"Ups! Wygl� |
| 2992 |
da na to, że ten post nie został jeszcze opublikowany. B� |
| 2993 |
dź na " |
| 2994 |
"bież� |
| 2995 |
co z aktualizacjami!" |
| 2996 |
|
| 2997 |
#: legacy/public/classes/class-wpvr-shortcode.php:131 legacy/wpvr.php:721 |
| 2998 |
msgid "You need to log in to access this content." |
| 2999 |
msgstr "" |
| 3000 |
|
| 3001 |
#: legacy/public/classes/class-wpvr-shortcode.php:179 legacy/wpvr.php:762 |
| 3002 |
msgid "You do not have access to this content." |
| 3003 |
msgstr "" |
| 3004 |
|
| 3005 |
#: legacy/wpvr.php:156 |
| 3006 |
msgid "You are previewing Pro features in action." |
| 3007 |
msgstr "" |
| 3008 |
|
| 3009 |
#: legacy/wpvr.php:160 |
| 3010 |
msgid "Normally $99.99/year" |
| 3011 |
msgstr "" |
| 3012 |
|
| 3013 |
#: legacy/wpvr.php:161 |
| 3014 |
msgid "SAVE 20%" |
| 3015 |
msgstr "" |
| 3016 |
|
| 3017 |
#: legacy/wpvr.php:163 |
| 3018 |
msgid "Starting at $79.99/year" |
| 3019 |
msgstr "" |
| 3020 |
|
| 3021 |
#: legacy/wpvr.php:167 |
| 3022 |
#, fuzzy |
| 3023 |
msgid "Upgrade to save changes" |
| 3024 |
msgstr "Uaktualnij do Pro" |
| 3025 |
|
| 3026 |
#: legacy/wpvr.php:379 |
| 3027 |
msgid "By" |
| 3028 |
msgstr "" |
| 3029 |
|
| 3030 |
#: legacy/wpvr.php:811 |
| 3031 |
msgid "" |
| 3032 |
"Oops! It seems that you have not selected any tour yet. Please select a tour " |
| 3033 |
"from the dropdown of WPVR block.<br>" |
| 3034 |
msgstr "" |
| 3035 |
|
| 3036 |
#: legacy/wpvr.php:4208 |
| 3037 |
msgid "" |
| 3038 |
"Since you have updated the plugin, please clear the browser cache for smooth " |
| 3039 |
"functioning. Follow these steps if you are using <a href=\"https://support." |
| 3040 |
"google.com/accounts/answer/32050?co=GENIE.Platform%3DDesktop&hl=en\" target=" |
| 3041 |
"\"_blank\">Google Chrome</a>, <a href=\"https://support.mozilla.org/en-US/kb/" |
| 3042 |
"how-clear-firefox-cache\" target=\"_blank\">Mozilla Firefox</a>, <a href=" |
| 3043 |
"\"https://clear-my-cache.com/en/apple-mac-os/safari.html\" target=\"_blank" |
| 3044 |
"\">Safai</a> or <a href=\"https://support.microsoft.com/en-us/help/10607/" |
| 3045 |
"microsoft-edge-view-delete-browser-history\" target=\"_blank\">Microsoft " |
| 3046 |
"Edge</a>" |
| 3047 |
msgstr "" |
| 3048 |
"Ponieważ zaktualizowałeś wtyczkę, wyczyść pamięć podręczn� |
| 3049 |
przegl� |
| 3050 |
darki, aby " |
| 3051 |
"zapewnić płynne działanie. Wykonaj następuj� |
| 3052 |
ce kroki, jeśli używasz <a href=" |
| 3053 |
"\"https://support.google.com/accounts/answer/32050?co=genie.platform" |
| 3054 |
"%3ddesktop&hl=pl\" target=\"_blank\">google chrome>, <a href=\"https://" |
| 3055 |
"supportull.molla.org/pl/s/how-clear-acre-cache chrome>, <a href=\"https://" |
| 3056 |
"www." |
| 3057 |
"actactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactacktactactactactactactacregweltackactactactactactactactactactactactacregcik-" |
| 3058 |
"acur-acreg-acrefur-acrefur-" |
| 3059 |
"supckactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactawna " |
| 3060 |
"lizak celour-" |
| 3061 |
"actactactactactactactactactactactactactactactactactactactactactactactac" |
| 3062 |
|
| 3063 |
#: src/Admin/Admin.php:120 |
| 3064 |
msgid "Edit" |
| 3065 |
msgstr "" |
| 3066 |
|
| 3067 |
#: src/Admin/Admin.php:318 src/Admin/UiModeSwitcher.php:33 |
| 3068 |
msgid "Switch to Classic UI" |
| 3069 |
msgstr "" |
| 3070 |
|
| 3071 |
#: src/Admin/Admin.php:322 src/Admin/UiModeSwitcher.php:37 |
| 3072 |
msgid "You are using the latest WP VR editor." |
| 3073 |
msgstr "" |
| 3074 |
|
| 3075 |
#: src/Admin/Admin.php:333 src/Admin/UiModeSwitcher.php:159 |
| 3076 |
msgid "You are not allowed to switch UI modes." |
| 3077 |
msgstr "" |
| 3078 |
|
| 3079 |
#: src/Admin/Admin.php:487 |
| 3080 |
#, fuzzy |
| 3081 |
msgid "Create New Tour" |
| 3082 |
msgstr "Dodaj now� |
| 3083 |
wycieczkę" |
| 3084 |
|
| 3085 |
#: src/Admin/Admin.php:488 |
| 3086 |
msgid "Choose your tour type and get started" |
| 3087 |
msgstr "" |
| 3088 |
|
| 3089 |
#: src/Admin/Admin.php:504 |
| 3090 |
msgid "Enter tour name..." |
| 3091 |
msgstr "" |
| 3092 |
|
| 3093 |
#: src/Admin/Admin.php:508 |
| 3094 |
msgid "Tour name is required." |
| 3095 |
msgstr "" |
| 3096 |
|
| 3097 |
#: src/Admin/Admin.php:526 |
| 3098 |
msgid "360° Image" |
| 3099 |
msgstr "" |
| 3100 |
|
| 3101 |
#: src/Admin/Admin.php:527 |
| 3102 |
msgid "Create immersive panoramic image tours" |
| 3103 |
msgstr "" |
| 3104 |
|
| 3105 |
#: src/Admin/Admin.php:538 |
| 3106 |
#, fuzzy |
| 3107 |
msgid "360° Video" |
| 3108 |
msgstr "Wideo 360 stopni" |
| 3109 |
|
| 3110 |
#: src/Admin/Admin.php:539 |
| 3111 |
msgid "Build dynamic video-based experiences" |
| 3112 |
msgstr "" |
| 3113 |
|
| 3114 |
#: src/Admin/Admin.php:547 |
| 3115 |
msgid "Requires WP VR Pro" |
| 3116 |
msgstr "" |
| 3117 |
|
| 3118 |
#: src/Admin/Admin.php:557 |
| 3119 |
#, fuzzy |
| 3120 |
msgid "Integrate Google Street View locations" |
| 3121 |
msgstr "Widok ulicy Google" |
| 3122 |
|
| 3123 |
#: src/Admin/Admin.php:571 |
| 3124 |
msgid "+ Create Tour" |
| 3125 |
msgstr "" |
| 3126 |
|
| 3127 |
#: src/Admin/UiModeSwitcher.php:34 |
| 3128 |
msgid "Switch to New UI" |
| 3129 |
msgstr "" |
| 3130 |
|
| 3131 |
#: src/Admin/UiModeSwitcher.php:38 |
| 3132 |
msgid "You are using the classic WP VR editor." |
| 3133 |
msgstr "" |
| 3134 |
|
| 3135 |
#: src/Api/Controllers/TourController.php:87 |
| 3136 |
#: src/Api/Controllers/TourController.php:103 |
| 3137 |
#: src/Api/Controllers/TourController.php:136 |
| 3138 |
msgid "Tour not found." |
| 3139 |
msgstr "" |
| 3140 |
|
| 3141 |
#: src/Api/Controllers/TourController.php:110 |
| 3142 |
msgid "Save failed." |
| 3143 |
msgstr "" |
| 3144 |
|
| 3145 |
#: src/Api/Controllers/TourController.php:124 |
| 3146 |
msgid "Tour title or status could not be saved." |
| 3147 |
msgstr "" |
| 3148 |
|
| 3149 |
#: src/Api/Controllers/TourController.php:140 |
| 3150 |
msgid "Tour could not be deleted." |
| 3151 |
msgstr "" |
| 3152 |
|
| 3153 |
#: wpvr.php:415 |
| 3154 |
msgid "Please Activate your license key to enjoy the pro features for WPVR" |
| 3155 |
msgstr "" |
| 3156 |
|
| 3157 |
#: wpvr.php:417 |
| 3158 |
#, fuzzy |
| 3159 |
msgid "Activate" |
| 3160 |
msgstr "Aktywuj licencję" |
| 3161 |
|
| 3162 |
#: wpvr.php:423 |
| 3163 |
msgid "Your WPVR Pro license has expired." |
| 3164 |
msgstr "" |
| 3165 |
|
| 3166 |
#: wpvr.php:424 |
| 3167 |
msgid "Your WPVR Pro license is not active." |
| 3168 |
msgstr "" |
| 3169 |
|
| 3170 |
#: wpvr.php:425 |
| 3171 |
msgid "" |
| 3172 |
"Pro features are no longer available. Upgrade to Pro now to restore access " |
| 3173 |
"to all premium features." |
| 3174 |
msgstr "" |
| 3175 |
|
| 3176 |
#: wpvr.php:449 |
| 3177 |
msgid "Dismiss this notice." |
| 3178 |
msgstr "" |
| 3179 |
|
| 3180 |
#: app/components/modals/CreateSceneModal.jsx:41 |
| 3181 |
msgid "Selected image" |
| 3182 |
msgstr "" |
| 3183 |
|
| 3184 |
#: app/components/modals/CreateSceneModal.jsx:128 |
| 3185 |
msgid "You cannot add any more scenes in this operation." |
| 3186 |
msgstr "" |
| 3187 |
|
| 3188 |
#. translators: %d: number of images that can still be selected. |
| 3189 |
#: app/components/modals/CreateSceneModal.jsx:134 |
| 3190 |
msgid "You can add only %d more image(s) in this operation." |
| 3191 |
msgstr "" |
| 3192 |
|
| 3193 |
#. translators: %s: comma-separated invalid image file names. |
| 3194 |
#: app/components/modals/CreateSceneModal.jsx:152 |
| 3195 |
msgid "Unsupported image file(s): %s. Please use JPEG, PNG, TIFF, or WebP." |
| 3196 |
msgstr "" |
| 3197 |
|
| 3198 |
#. translators: %d: position of the new scene in the current operation. |
| 3199 |
#: app/components/modals/CreateSceneModal.jsx:173 |
| 3200 |
msgid "Untitled Scene - %d" |
| 3201 |
msgstr "" |
| 3202 |
|
| 3203 |
#: app/components/modals/CreateSceneModal.jsx:234 |
| 3204 |
#, fuzzy |
| 3205 |
msgid "Select Panorama Images" |
| 3206 |
msgstr "Prześlij obraz panoramy" |
| 3207 |
|
| 3208 |
#: app/components/modals/CreateSceneModal.jsx:235 |
| 3209 |
msgid "Use these images" |
| 3210 |
msgstr "" |
| 3211 |
|
| 3212 |
#: app/components/modals/CreateSceneModal.jsx:339 |
| 3213 |
msgid "Enter a name for every scene before creating." |
| 3214 |
msgstr "" |
| 3215 |
|
| 3216 |
#. translators: %s: comma-separated file names that failed to upload. |
| 3217 |
#: app/components/modals/CreateSceneModal.jsx:398 |
| 3218 |
msgid "Could not upload: %s. Please try creating the scenes again." |
| 3219 |
msgstr "" |
| 3220 |
|
| 3221 |
#: app/components/modals/CreateSceneModal.jsx:418 |
| 3222 |
msgid "Unable to create the selected scenes. Please try again." |
| 3223 |
msgstr "" |
| 3224 |
|
| 3225 |
#: app/components/modals/CreateSceneModal.jsx:449 |
| 3226 |
msgid "+ Create" |
| 3227 |
msgstr "" |
| 3228 |
|
| 3229 |
#: app/components/modals/CreateSceneModal.jsx:451 |
| 3230 |
#, fuzzy |
| 3231 |
msgid "+ Create Scene" |
| 3232 |
msgstr "Identyfikator sceny docelowe" |
| 3233 |
|
| 3234 |
#. translators: %d: number of scenes that will be created. |
| 3235 |
#: app/components/modals/CreateSceneModal.jsx:455 |
| 3236 |
msgid "+ Create %d Scenes" |
| 3237 |
msgstr "" |
| 3238 |
|
| 3239 |
#: app/components/modals/CreateSceneModal.jsx:465 |
| 3240 |
msgid "Create scenes" |
| 3241 |
msgstr "" |
| 3242 |
|
| 3243 |
#: app/components/modals/CreateSceneModal.jsx:470 |
| 3244 |
msgid "Upload Scene" |
| 3245 |
msgstr "" |
| 3246 |
|
| 3247 |
#: app/components/modals/CreateSceneModal.jsx:494 |
| 3248 |
msgid "Drag and drop your 360° panorama images here" |
| 3249 |
msgstr "" |
| 3250 |
|
| 3251 |
#: app/components/modals/CreateSceneModal.jsx:501 |
| 3252 |
msgid "Supports JPEG, PNG, TIFF, WebP" |
| 3253 |
msgstr "" |
| 3254 |
|
| 3255 |
#: app/components/modals/CreateSceneModal.jsx:514 |
| 3256 |
msgid "Browse Files" |
| 3257 |
msgstr "" |
| 3258 |
|
| 3259 |
#. translators: 1: number of uploaded images, 2: total image uploads. |
| 3260 |
#: app/components/modals/CreateSceneModal.jsx:529 |
| 3261 |
msgid "Uploading %1$d of %2$d images…" |
| 3262 |
msgstr "" |
| 3263 |
|
| 3264 |
#. translators: 1: number of selected scenes, 2: maximum scenes allowed in this operation. |
| 3265 |
#: app/components/modals/CreateSceneModal.jsx:543 |
| 3266 |
msgid "%1$d of %2$d scenes selected." |
| 3267 |
msgstr "" |
| 3268 |
|
| 3269 |
#. translators: %d: number of scenes that can still be added in this operation. |
| 3270 |
#: app/components/modals/CreateSceneModal.jsx:554 |
| 3271 |
msgid "You can add %d more scene(s) with your current limit." |
| 3272 |
msgstr "" |
| 3273 |
|
| 3274 |
#. translators: %s: image file name. |
| 3275 |
#: app/components/modals/CreateSceneModal.jsx:584 |
| 3276 |
msgid "Remove %s" |
| 3277 |
msgstr "" |
| 3278 |
|
| 3279 |
#: app/components/modals/CreateSceneModal.jsx:599 |
| 3280 |
#, fuzzy |
| 3281 |
msgid "Scene name" |
| 3282 |
msgstr "Typ sceny" |
| 3283 |
|
| 3284 |
#: app/components/modals/ImageResizeWarningModal.jsx:59 |
| 3285 |
msgid "Could not save the setting. Please try again." |
| 3286 |
msgstr "" |
| 3287 |
|
| 3288 |
#: legacy/src/index.js:42 |
| 3289 |
msgid "Solid" |
| 3290 |
msgstr "" |
| 3291 |
|
| 3292 |
#: legacy/src/index.js:43 |
| 3293 |
msgid "Dotted" |
| 3294 |
msgstr "" |
| 3295 |
|
| 3296 |
#: legacy/src/index.js:44 |
| 3297 |
msgid "Dashed" |
| 3298 |
msgstr "" |
| 3299 |
|
| 3300 |
#: legacy/src/index.js:45 |
| 3301 |
msgid "Double" |
| 3302 |
msgstr "" |
| 3303 |
|
| 3304 |
#: legacy/src/index.js:132 |
| 3305 |
#, fuzzy |
| 3306 |
msgid "Tour Settings" |
| 3307 |
msgstr "Ustawienie" |
| 3308 |
|
| 3309 |
#: legacy/src/index.js:187 |
| 3310 |
msgid "Appearance" |
| 3311 |
msgstr "" |
| 3312 |
|
| 3313 |
#: legacy/src/index.js:189 |
| 3314 |
#, fuzzy |
| 3315 |
msgid "Tour Border Radius" |
| 3316 |
msgstr "Promień granicy (PX)" |
| 3317 |
|
| 3318 |
#: legacy/src/index.js:204 |
| 3319 |
msgid "Tour Border Width" |
| 3320 |
msgstr "" |
| 3321 |
|
| 3322 |
#: legacy/src/index.js:212 |
| 3323 |
msgid "Tour Border Style" |
| 3324 |
msgstr "" |
| 3325 |
|
| 3326 |
#: legacy/src/index.js:219 |
| 3327 |
msgid "Tour Border Color" |
| 3328 |
msgstr "" |
| 3329 |
|
| 3330 |
#: legacy/src/index.js:235 |
| 3331 |
#, fuzzy |
| 3332 |
msgid "WPVR Tour Preview" |
| 3333 |
msgstr "Podgl� |
| 3334 |
d wycieczki" |
| 3335 |
|
| 3336 |
#: legacy/src/index.js:238 |
| 3337 |
msgid "Width" |
| 3338 |
msgstr "szerokość" |
| 3339 |
|
| 3340 |
#: legacy/src/index.js:239 |
| 3341 |
msgid "Height" |
| 3342 |
msgstr "zenit" |
| 3343 |
|
| 3344 |
#: legacy/src/index.js:241 |
| 3345 |
msgid "Radius" |
| 3346 |
msgstr "promień" |
| 3347 |
|
| 3348 |
#: legacy/src/index.js:247 |
| 3349 |
msgid "Please select a tour from the block settings panel." |
| 3350 |
msgstr "" |
| 3351 |
|
| 3352 |
#: legacy/src/index.js:258 |
| 3353 |
#, fuzzy |
| 3354 |
msgid "WPVR Tour" |
| 3355 |
msgstr "Identyfikator trasy WPVR" |
| 3356 |
|
| 3357 |
#: legacy/src/index.js:259 |
| 3358 |
msgid "Add a virtual reality tour to your content." |
| 3359 |
msgstr "" |
| 3360 |
|
| 3361 |
#: legacy/src/index.js:262 |
| 3362 |
msgid "vr" |
| 3363 |
msgstr "" |
| 3364 |
|
| 3365 |
#: legacy/src/index.js:262 |
| 3366 |
msgid "tour" |
| 3367 |
msgstr "" |
| 3368 |
|
| 3369 |
#: legacy/src/index.js:262 |
| 3370 |
#, fuzzy |
| 3371 |
msgid "panorama" |
| 3372 |
msgstr "Mobilna panorama" |
| 3373 |
|
| 3374 |
#: legacy/src/index.js:262 |
| 3375 |
msgid "virtual reality" |
| 3376 |
msgstr "" |
| 3377 |
|
| 3378 |
#~ msgid " : " |
| 3379 |
#~ msgstr ": :" |
| 3380 |
|
| 3381 |
#~ msgid "360 Degree Panorama" |
| 3382 |
#~ msgstr "Panorama 360 stopni" |
| 3383 |
|
| 3384 |
#~ msgid ": " |
| 3385 |
#~ msgstr ": :" |
| 3386 |
|
| 3387 |
#~ msgid "add" |
| 3388 |
#~ msgstr "dopłacać" |
| 3389 |
|
| 3390 |
#~ msgid "" |
| 3391 |
#~ "Add a Hotspot inside your tour to show additional information like " |
| 3392 |
#~ "Paragraph, Heading, Image, Video, or multiple content." |
| 3393 |
#~ msgstr "" |
| 3394 |
#~ "Dodaj hotspot do wycieczki, aby wyświetlić dodatkowe informacje, takie " |
| 3395 |
#~ "jak akapit, nagłówek, obraz, wideo lub wiele treści." |
| 3396 |
|
| 3397 |
#~ msgid "Add Scene ID " |
| 3398 |
#~ msgstr "Dodaj identyfikator sceny" |
| 3399 |
|
| 3400 |
#~ msgid "Add-ons" |
| 3401 |
#~ msgstr "dodatki" |
| 3402 |
|
| 3403 |
#~ msgid "Assign Pitch & Yaw" |
| 3404 |
#~ msgstr "Przypisz skok i odchyl" |
| 3405 |
|
| 3406 |
#~ msgid "Back to WPVR Dashboard" |
| 3407 |
#~ msgstr "Powrót do WPVR Pulpit nawigacyjny" |
| 3408 |
|
| 3409 |
#~ msgid "Background Audio" |
| 3410 |
#~ msgstr "Dźwięk w tle" |
| 3411 |
|
| 3412 |
#~ msgid "" |
| 3413 |
#~ "Before You start, you can check our Documentation to get familiar with WP " |
| 3414 |
#~ "VR - 360 Panorama and virtual tour creator for WordPress." |
| 3415 |
#~ msgstr "" |
| 3416 |
#~ "Zanim zaczniesz, możesz sprawdzić nasz� |
| 3417 |
dokumentację, aby zapoznać się z " |
| 3418 |
#~ "WP VR - 360 Panorama i Virtual Tour Creator dla WordPress." |
| 3419 |
|
| 3420 |
#~ msgid "Best WordPress Plugin" |
| 3421 |
#~ msgstr "Najlepsza wtyczka WordPress" |
| 3422 |
|
| 3423 |
#~ msgid "Call to action button text" |
| 3424 |
#~ msgstr "Tekst przycisku wezwania do działania" |
| 3425 |
|
| 3426 |
#~ msgid "" |
| 3427 |
#~ "Can't find solution on with our documentation? Just Post a ticket on " |
| 3428 |
#~ "Support forum. We are to solve your issue." |
| 3429 |
#~ msgstr "" |
| 3430 |
#~ "Nie możesz znaleźć rozwi� |
| 3431 |
zania z nasz� |
| 3432 |
dokumentacj� |
| 3433 |
? Po prostu opublikuj " |
| 3434 |
#~ "bilet na forum pomocy technicznej. Mamy rozwi� |
| 3435 |
zać Twój problem." |
| 3436 |
|
| 3437 |
#~ msgid "Cart Lift" |
| 3438 |
#~ msgstr "Wózek podnośnikowy" |
| 3439 |
|
| 3440 |
#~ msgid "Check out our other amazing free plugins!" |
| 3441 |
#~ msgstr "Sprawdź nasze inne niesamowite darmowe wtyczki!" |
| 3442 |
|
| 3443 |
#~ msgid "Checkout All Features" |
| 3444 |
#~ msgstr "Sprawdź wszystkie funkcje" |
| 3445 |
|
| 3446 |
#~ msgid "Choose The Spot" |
| 3447 |
#~ msgstr "Wybierz miejsce" |
| 3448 |
|
| 3449 |
#~ msgid "" |
| 3450 |
#~ "Click on Preview to see how the content is appearing for the hotspot." |
| 3451 |
#~ msgstr "" |
| 3452 |
#~ "Kliknij podgl� |
| 3453 |
d, aby zobaczyć, jak treść wyświetla się dla hotspotu." |
| 3454 |
|
| 3455 |
#~ msgid "" |
| 3456 |
#~ "Click on the Preview button to view your uploaded panorama in virtual " |
| 3457 |
#~ "tour mode." |
| 3458 |
#~ msgstr "" |
| 3459 |
#~ "Kliknij przycisk Podgl� |
| 3460 |
d, aby wyświetlić przesłan� |
| 3461 |
panoramę w trybie " |
| 3462 |
#~ "wirtualnej wycieczki." |
| 3463 |
|
| 3464 |
#~ msgid "" |
| 3465 |
#~ "Click on the Update button to save your work. And just like that, you can " |
| 3466 |
#~ "create an unlimited number of virtual tours and add your customization to " |
| 3467 |
#~ "them." |
| 3468 |
#~ msgstr "" |
| 3469 |
#~ "Kliknij przycisk Aktualizuj, aby zapisać swoj� |
| 3470 |
pracę. I tak po prostu " |
| 3471 |
#~ "możesz tworzyć nieograniczon� |
| 3472 |
liczbę wirtualnych wycieczek i dodawać do " |
| 3473 |
#~ "nich swoj� |
| 3474 |
personalizację." |
| 3475 |
|
| 3476 |
#~ msgid "Click on the Upload button to upload your panorama image." |
| 3477 |
#~ msgstr "Kliknij przycisk Prześlij, aby przesłać obraz panoramy." |
| 3478 |
|
| 3479 |
#~ msgid "" |
| 3480 |
#~ "Click on this Publish button to save this as a tour. You can always find " |
| 3481 |
#~ "it in your tour list." |
| 3482 |
#~ msgstr "" |
| 3483 |
#~ "Kliknij ten przycisk Publikuj, aby zapisać to jako wycieczkę. Zawsze " |
| 3484 |
#~ "możesz go znaleźć na swojej liście wycieczek." |
| 3485 |
|
| 3486 |
#~ msgid "Click to Upload an Image " |
| 3487 |
#~ msgstr "Kliknij, aby przesłać obraz" |
| 3488 |
|
| 3489 |
#~ msgid "Contact Our Support" |
| 3490 |
#~ msgstr "Skontaktuj się z naszym wsparciem" |
| 3491 |
|
| 3492 |
#~ msgid "Continue to guide" |
| 3493 |
#~ msgstr "Kontynuuj do przewodnika" |
| 3494 |
|
| 3495 |
#~ msgid "" |
| 3496 |
#~ "Create high-converting slaes funnels on a visual drag & drop funnel " |
| 3497 |
#~ "builder canvas and increase your online sales from today." |
| 3498 |
#~ msgstr "" |
| 3499 |
#~ "Twórz ścieżki SLAES o wysokim konwersji na wizualnym kanwie konstruktora " |
| 3500 |
#~ "lejka przeci� |
| 3501 |
gnij i upuść i zwiększ sprzedaż online od dzisiaj." |
| 3502 |
|
| 3503 |
#~ msgid "Cubemap Images" |
| 3504 |
#~ msgstr "Obrazy z map� |
| 3505 |
" |
| 3506 |
|
| 3507 |
#~| msgid "Custom control buttons" |
| 3508 |
#~ msgid "Custom Control Buttons" |
| 3509 |
#~ msgstr "Niestandardowe przyciski sterowania" |
| 3510 |
|
| 3511 |
#~ msgid "" |
| 3512 |
#~ "Custom icons will only show on frontend. Hotspot custom icons only works " |
| 3513 |
#~ "with fontawesome 5. If you are using any different version of fontawesome " |
| 3514 |
#~ "under theme or any plugin, you may deactivate fontawesome from WP VR. Go " |
| 3515 |
#~ "to \"Get Started menu\" and select \"Role\" and check fontawesome disable " |
| 3516 |
#~ "switch. Now put your desired any icon class under \"Hotspot custom icon " |
| 3517 |
#~ "class\" field. It will appear on the frontend." |
| 3518 |
#~ msgstr "" |
| 3519 |
#~ "Niestandardowe ikony będ� |
| 3520 |
wyświetlane tylko na frontend. Niestandardowe " |
| 3521 |
#~ "ikony Hotspot działa tylko z FontaWesome 5. Jeśli używasz innej wersji " |
| 3522 |
#~ "FontaWesome pod motywem lub jak� |
| 3523 |
kolwiek wtyczk� |
| 3524 |
, możesz dezaktywować " |
| 3525 |
#~ "FontaWesome z WP VR. Przejdź do \"Menu Rozpocznij\" i wybierz \"Role\" i " |
| 3526 |
#~ "zaznacz FontaWesome Disable Switch. Teraz umieść ż� |
| 3527 |
dan� |
| 3528 |
klasę ikon w polu " |
| 3529 |
#~ "„Hotspot Custom Icon Class”. Pojawi się na froncie." |
| 3530 |
|
| 3531 |
#~ msgid "Decisions" |
| 3532 |
#~ msgstr "decyzja" |
| 3533 |
|
| 3534 |
#~ msgid "Disable keyboard control to use the form." |
| 3535 |
#~ msgstr "Wył� |
| 3536 |
cz kontrolę klawiatury, aby użyć formularza." |
| 3537 |
|
| 3538 |
#~ msgid "" |
| 3539 |
#~ "Do not close or refresh the page during import process. It may take few " |
| 3540 |
#~ "minutes." |
| 3541 |
#~ msgstr "" |
| 3542 |
#~ "Nie zamykaj ani nie odświeżaj strony podczas procesu importowania. Może " |
| 3543 |
#~ "to zaj� |
| 3544 |
ć kilka minut." |
| 3545 |
|
| 3546 |
#~ msgid "" |
| 3547 |
#~ "Editors will be able to Create, Edit, Update, and Delete all virtual " |
| 3548 |
#~ "tours." |
| 3549 |
#~ msgstr "" |
| 3550 |
#~ "Edytorzy będ� |
| 3551 |
mogli tworzyć, edytować, aktualizować i usuwać wszystkie " |
| 3552 |
#~ "wirtualne wycieczki." |
| 3553 |
|
| 3554 |
#~ msgid "Enable the call to action, it will render under the tour." |
| 3555 |
#~ msgstr "Wł� |
| 3556 |
cz wezwanie do działania, zostanie wyrenderowane w ramach trasy." |
| 3557 |
|
| 3558 |
#~ msgid "Enable Video" |
| 3559 |
#~ msgstr "Wł� |
| 3560 |
cz wideo" |
| 3561 |
|
| 3562 |
#~ msgid "Explainer" |
| 3563 |
#~ msgstr "wyjaśniacz" |
| 3564 |
|
| 3565 |
#~ msgid "Features That Can" |
| 3566 |
#~ msgstr "Funkcje, które mog� |
| 3567 |
" |
| 3568 |
|
| 3569 |
#~ msgid "Follow the Guided Wizard and Learn How it Works." |
| 3570 |
#~ msgstr "" |
| 3571 |
#~ "Postępuj zgodnie z przewodnikiem kreatora i dowiedz się, jak to działa." |
| 3572 |
|
| 3573 |
#~ msgid "for Choosing" |
| 3574 |
#~ msgstr "za wybór" |
| 3575 |
|
| 3576 |
#~ msgid "for Virtual Tours, Viewing Panoramas, and 360 Degree Content" |
| 3577 |
#~ msgstr "" |
| 3578 |
#~ "W przypadku wirtualnych wycieczek, przegl� |
| 3579 |
dania panoram i zawartości 360 " |
| 3580 |
#~ "stopni" |
| 3581 |
|
| 3582 |
#~ msgid "Full Screen" |
| 3583 |
#~ msgstr "pełny ekran" |
| 3584 |
|
| 3585 |
#~ msgid "General" |
| 3586 |
#~ msgstr "gromadny" |
| 3587 |
|
| 3588 |
#~ msgid "Get Access to " |
| 3589 |
#~ msgstr "Uzyskaj dostęp do" |
| 3590 |
|
| 3591 |
#~ msgid "Get It Now" |
| 3592 |
#~ msgstr "Pobierz to teraz" |
| 3593 |
|
| 3594 |
#~ msgid "Get Pro Now" |
| 3595 |
#~ msgstr "Zdob� |
| 3596 |
dź profesjonalistę" |
| 3597 |
|
| 3598 |
#~ msgid "Give a name to your virtual tour." |
| 3599 |
#~ msgstr "Nadaj nazwę swojej wirtualnej trasie." |
| 3600 |
|
| 3601 |
#~ msgid "Gyroscope" |
| 3602 |
#~ msgstr "giroskop" |
| 3603 |
|
| 3604 |
#~ msgid "" |
| 3605 |
#~ "Here is a preview of your panorama image in tour mode. You can control it " |
| 3606 |
#~ "and mode around to see it in 360 degree view." |
| 3607 |
#~ msgstr "" |
| 3608 |
#~ "Oto podgl� |
| 3609 |
d Twojego obrazu panoramy w trybie wycieczki. Możesz nim " |
| 3610 |
#~ "sterować i trybu wokół, aby zobaczyć go w widoku 360 stopni." |
| 3611 |
|
| 3612 |
#~ msgid "Here you can see the Pitch & Yaw has been set for the hotspot." |
| 3613 |
#~ msgstr "" |
| 3614 |
#~ "Tutaj możesz zobaczyć, że boisko i Yaw zostało ustawione dla hotspotu." |
| 3615 |
|
| 3616 |
#~ msgid "" |
| 3617 |
#~ "Here, you can set what content your viewer will see after clicking on the " |
| 3618 |
#~ "Hotspot. You can either set an URL or any other content using this " |
| 3619 |
#~ "editor. To learn more, follow this guide to set content using editor" |
| 3620 |
#~ msgstr "" |
| 3621 |
#~ "Tutaj możesz ustawić, jakie treści zobaczy Twój widz po kliknięciu w " |
| 3622 |
#~ "hotspot. Możesz ustawić adres URL lub inn� |
| 3623 |
zawartość za pomoc� |
| 3624 |
tego " |
| 3625 |
#~ "edytora. Aby dowiedzieć się więcej, postępuj zgodnie z tym przewodnikiem, " |
| 3626 |
#~ "aby ustawić zawartość za pomoc� |
| 3627 |
edytora" |
| 3628 |
|
| 3629 |
#~ msgid "Home" |
| 3630 |
#~ msgstr "ojczyzna" |
| 3631 |
|
| 3632 |
#~ msgid "Hook" |
| 3633 |
#~ msgstr "uczepić" |
| 3634 |
|
| 3635 |
#~ msgid "ID" |
| 3636 |
#~ msgstr "dowód osobisty" |
| 3637 |
|
| 3638 |
#~ msgid "ID:" |
| 3639 |
#~ msgstr "ID:" |
| 3640 |
|
| 3641 |
#~ msgid "" |
| 3642 |
#~ "If set to true, device orientation control will be used when the panorama " |
| 3643 |
#~ "is loaded, if the device supports it. If false, device orientation " |
| 3644 |
#~ "control needs to be activated by pressing a button. Defaults to false. " |
| 3645 |
#~ "Will work if gyroscope is enabled" |
| 3646 |
#~ msgstr "" |
| 3647 |
#~ "Jeśli ustawione na true, kontrola orientacji urz� |
| 3648 |
dzenia będzie używana, " |
| 3649 |
#~ "gdy panorama jest załadowana, jeśli urz� |
| 3650 |
dzenie j� |
| 3651 |
obsługuje. Jeśli false, " |
| 3652 |
#~ "kontrola orientacji urz� |
| 3653 |
dzenia musi być aktywowana przez naciśnięcie " |
| 3654 |
#~ "przycisku. domyślnie na false. będzie działać, jeśli żyroskop jest " |
| 3655 |
#~ "wł� |
| 3656 |
czony" |
| 3657 |
|
| 3658 |
#~ msgid "" |
| 3659 |
#~ "In this Preview, drag to your desired location and click on it, exactly " |
| 3660 |
#~ "where you want to set the hotspot" |
| 3661 |
#~ msgstr "" |
| 3662 |
#~ "W tym podgl� |
| 3663 |
dzie przeci� |
| 3664 |
gnij do ż� |
| 3665 |
danej lokalizacji i kliknij j� |
| 3666 |
, " |
| 3667 |
#~ "dokładnie tam, gdzie chcesz ustawić hotspot" |
| 3668 |
|
| 3669 |
#~ msgid "Learn more" |
| 3670 |
#~ msgstr "Więcej" |
| 3671 |
|
| 3672 |
#~ msgid "Make WPVR Popular" |
| 3673 |
#~ msgstr "Spraw, aby WPVR był popularny" |
| 3674 |
|
| 3675 |
#~ msgid "More Pro Features" |
| 3676 |
#~ msgstr "Więcej funkcji Pro" |
| 3677 |
|
| 3678 |
#~ msgid "Move Up" |
| 3679 |
#~ msgstr "podnieść" |
| 3680 |
|
| 3681 |
#~ msgid "Multiple Content on Hotspots" |
| 3682 |
#~ msgstr "Wiele treści w hotspotach" |
| 3683 |
|
| 3684 |
#~ msgid "" |
| 3685 |
#~ "Once you see the Pitch & Yaw value for the spot, click on this Arrow. " |
| 3686 |
#~ "It'll be set as the coordinate for your hotspot" |
| 3687 |
#~ msgstr "" |
| 3688 |
#~ "Gdy zobaczysz wartość Pitch & Yaw dla miejsca, kliknij tę strzałkę. " |
| 3689 |
#~ "zostanie ustawiony jako współrzędna dla twojego hotspotu" |
| 3690 |
|
| 3691 |
#~ msgid "Personalize your virtual tours, in the way you want." |
| 3692 |
#~ msgstr "Spersonalizuj swoje wirtualne wycieczki w sposób, w jaki chcesz." |
| 3693 |
|
| 3694 |
#~ msgid "Pitch & Yaw is Set" |
| 3695 |
#~ msgstr "Pitch & Yaw jest ustawiony" |
| 3696 |
|
| 3697 |
#~ msgid "Post a Ticket" |
| 3698 |
#~ msgstr "Opublikuj bilet" |
| 3699 |
|
| 3700 |
#~ msgid "Preview The Image in Tour Mode" |
| 3701 |
#~ msgstr "Podgl� |
| 3702 |
d obrazu w trybie wycieczki" |
| 3703 |
|
| 3704 |
#~ msgid "Preview Your Hotspot Content" |
| 3705 |
#~ msgstr "Wyświetl podgl� |
| 3706 |
d zawartości Hotspot" |
| 3707 |
|
| 3708 |
#~| msgid "Rate Us! " |
| 3709 |
#~ msgid "Rate Us " |
| 3710 |
#~ msgstr "Oceń nas" |
| 3711 |
|
| 3712 |
#~ msgid "Read Documentations" |
| 3713 |
#~ msgstr "Przeczytaj dokumentację" |
| 3714 |
|
| 3715 |
#~ msgid "Read Our Complete Guides" |
| 3716 |
#~ msgstr "Przeczytaj nasze kompletne przewodniki" |
| 3717 |
|
| 3718 |
#~ msgid "" |
| 3719 |
#~ "Recover abandoned carts with automated email drip campaigns. Start " |
| 3720 |
#~ "getting back lost sales on your online store." |
| 3721 |
#~ msgstr "" |
| 3722 |
#~ "Odzyskiwanie porzuconych koszyków dzięki zautomatyzowanym kampaniom " |
| 3723 |
#~ "kroplowym. Zacznij odzyskiwać utracon� |
| 3724 |
sprzedaż w swoim sklepie " |
| 3725 |
#~ "internetowym." |
| 3726 |
|
| 3727 |
#~ msgid "Save" |
| 3728 |
#~ msgstr "uratować" |
| 3729 |
|
| 3730 |
#~ msgid "Save Your Progress" |
| 3731 |
#~ msgstr "Zapisz swoje postępy" |
| 3732 |
|
| 3733 |
#~ msgid "Sell WooCommerce Products" |
| 3734 |
#~ msgstr "Sprzedawaj produkty WooCommerce" |
| 3735 |
|
| 3736 |
#~ msgid "" |
| 3737 |
#~ "Set a time after which auto rotation will stop. Assign in milliseconds, " |
| 3738 |
#~ "where 1000 milliseconds = 1 second." |
| 3739 |
#~ msgstr "" |
| 3740 |
#~ "Ustaw czas, po którym zatrzyma się automatyczna obrót. Przypisz w " |
| 3741 |
#~ "milisekundach, gdzie 1000 milisekund = 1 sekunda." |
| 3742 |
|
| 3743 |
#~ msgid "Set a Title to Your Virtual Tour" |
| 3744 |
#~ msgstr "Ustaw tytuł na swoj� |
| 3745 |
wirtualn� |
| 3746 |
wycieczkę" |
| 3747 |
|
| 3748 |
#~ msgid "" |
| 3749 |
#~ "Set a value to determine the speed of rotation. The higher the number, " |
| 3750 |
#~ "the faster it will rotate. Positive values will make it rotate clockwise " |
| 3751 |
#~ "and negative values will make it rotate anti clockwise" |
| 3752 |
#~ msgstr "" |
| 3753 |
#~ "Ustaw wartość, aby określić prędkość obrotu. Im wyższa liczba, tym " |
| 3754 |
#~ "szybciej się obraca. Dodatnie wartości sprawi� |
| 3755 |
, że obróci się zgodnie z " |
| 3756 |
#~ "ruchem wskazówek zegara, a wartości ujemne sprawi� |
| 3757 |
, że obróci się " |
| 3758 |
#~ "przeciwnie do ruchu" |
| 3759 |
|
| 3760 |
#~ msgid "" |
| 3761 |
#~ "Set an unique Hotspot ID to each of your Hotspots. Avoid Spaces & special " |
| 3762 |
#~ "characters. Set it like H1 or 01" |
| 3763 |
#~ msgstr "" |
| 3764 |
#~ "Ustaw unikalny identyfikator hotspotu dla każdego ze swoich hotspotów. " |
| 3765 |
#~ "Unikaj spacji i znaków specjalnych. Ustaw to jak h1 lub 01" |
| 3766 |
|
| 3767 |
#~ msgid "Set Contact Form" |
| 3768 |
#~ msgstr "Ustaw formularz kontaktowy" |
| 3769 |
|
| 3770 |
#~ msgid "Set Hotspot ID" |
| 3771 |
#~ msgstr "Ustaw identyfikator hotspotu" |
| 3772 |
|
| 3773 |
#~ msgid "Set The Content for Click Action" |
| 3774 |
#~ msgstr "Ustaw treść dla akcji kliknięcia" |
| 3775 |
|
| 3776 |
#~ msgid "" |
| 3777 |
#~ "Set the Scene ID for your first panorama image. The Scene ID has to be " |
| 3778 |
#~ "unique for each scene and without any spaces or special characters. You " |
| 3779 |
#~ "can set it as Scene1, S1, or simply 01." |
| 3780 |
#~ msgstr "" |
| 3781 |
#~ "Ustaw identyfikator sceny dla pierwszego obrazu panoramy. Identyfikator " |
| 3782 |
#~ "sceny musi być unikalny dla każdej sceny i bez spacji i znaków " |
| 3783 |
#~ "specjalnych. Możesz ustawić go jako Scene1, S1 lub po prostu 01." |
| 3784 |
|
| 3785 |
#~ msgid "Share On" |
| 3786 |
#~ msgstr "dzielić na" |
| 3787 |
|
| 3788 |
#~ msgid "Starts from only" |
| 3789 |
#~ msgstr "zaczyna się tylko od" |
| 3790 |
|
| 3791 |
#~ msgid "Submit" |
| 3792 |
#~ msgstr "poddać pod" |
| 3793 |
|
| 3794 |
#~ msgid "Support" |
| 3795 |
#~ msgstr "dźwigać" |
| 3796 |
|
| 3797 |
#~ msgid "Take The Tour" |
| 3798 |
#~ msgstr "Weź udział w wycieczce" |
| 3799 |
|
| 3800 |
#~ msgid "Thank you" |
| 3801 |
#~ msgstr "dziękuję" |
| 3802 |
|
| 3803 |
#~ msgid "" |
| 3804 |
#~ "The notice will appear on the front end of the virtual tour if viewed " |
| 3805 |
#~ "from a mobile device." |
| 3806 |
#~ msgstr "" |
| 3807 |
#~ "Powiadomienie pojawi się na przedniej części wirtualnej wycieczki, jeśli " |
| 3808 |
#~ "jest ogl� |
| 3809 |
dane z urz� |
| 3810 |
dzenia mobilnego." |
| 3811 |
|
| 3812 |
#~ msgid "" |
| 3813 |
#~ "This option will display Zoom In, Zoom Out and Full Screen buttons on the " |
| 3814 |
#~ "tour." |
| 3815 |
#~ msgstr "" |
| 3816 |
#~ "Ta opcja wyświetli przyciski powiększenia, pomniejszenia i pełnego ekranu " |
| 3817 |
#~ "podczas trasy." |
| 3818 |
|
| 3819 |
#~ msgid "Tour Preview Image will not appear if this is turned on." |
| 3820 |
#~ msgstr "Obraz podgl� |
| 3821 |
du trasy nie pojawi się, jeśli jest wł� |
| 3822 |
czony." |
| 3823 |
|
| 3824 |
#~ msgid "" |
| 3825 |
#~ "Turning it On will display a gallery with all the scenes on your tour. By " |
| 3826 |
#~ "double clicking on a scene thumbnail on the gallery, you can move to that " |
| 3827 |
#~ "specific scene. The gallery will only show up on the front end and not on " |
| 3828 |
#~ "the preview." |
| 3829 |
#~ msgstr "" |
| 3830 |
#~ "Wł� |
| 3831 |
czenie go wyświetli galerię ze wszystkimi scenami podczas wycieczki. " |
| 3832 |
#~ "Dwukrotnie klikaj� |
| 3833 |
c miniaturę sceny w galerii, możesz przejść do tej " |
| 3834 |
#~ "konkretnej sceny. Galeria pojawi się tylko na przedniej stronie, a nie na " |
| 3835 |
#~ "podgl� |
| 3836 |
dzie." |
| 3837 |
|
| 3838 |
#~ msgid "Unlock all these options by upgrading to Premium version" |
| 3839 |
#~ msgstr "Odblokuj wszystkie te opcje, aktualizuj� |
| 3840 |
c wersję premium" |
| 3841 |
|
| 3842 |
#~ msgid "Upgrade Now" |
| 3843 |
#~ msgstr "Uaktualnij teraz" |
| 3844 |
|
| 3845 |
#~ msgid "Video Tutorials" |
| 3846 |
#~ msgstr "Samouczki wideo" |
| 3847 |
|
| 3848 |
#~ msgid "" |
| 3849 |
#~ "When someone clicks on the tour, auto-rotation stops. Here, set a time " |
| 3850 |
#~ "after which auto rotation will start again. Assign in milliseconds, where " |
| 3851 |
#~ "1000 milliseconds = 1 second." |
| 3852 |
#~ msgstr "" |
| 3853 |
#~ "Gdy ktoś kliknie na trasę, automatyczne obracanie zatrzymuje się. Tutaj " |
| 3854 |
#~ "ustaw czas, po którym automatyczne obracanie rozpocznie się ponownie. " |
| 3855 |
#~ "Przypisz w milisekundach, gdzie 1000 milisekund = 1 sekunda." |
| 3856 |
|
| 3857 |
#~ msgid "" |
| 3858 |
#~ "Will activate the VR Glass support on mobile devices. This is the Beta " |
| 3859 |
#~ "release. So, if you face any issues with it, please contact us at " |
| 3860 |
#~ "support@rextheme.com" |
| 3861 |
#~ msgstr "" |
| 3862 |
#~ "Aktywuje obsługę VR Glass na urz� |
| 3863 |
dzeniach mobilnych. To jest wydanie " |
| 3864 |
#~ "beta. Jeśli więc napotkasz jakiekolwiek problemy z nim, skontaktuj się z " |
| 3865 |
#~ "nami pod adresem support@rextheme.com" |
| 3866 |
|
| 3867 |
#~ msgid "" |
| 3868 |
#~ "Will convert any jpeg or png image to webp format during media upload. " |
| 3869 |
#~ "will decrease the image size with no quality compromise and help the site " |
| 3870 |
#~ "to load faster." |
| 3871 |
#~ msgstr "" |
| 3872 |
#~ "Przekonwertuje dowolny obraz JPEG lub PNG na format WebP podczas " |
| 3873 |
#~ "przesyłania multimediów. Zmniejszy rozmiar obrazu bez kompromisów jakości " |
| 3874 |
#~ "i pomoże witrynie szybciej się ładować." |
| 3875 |
|
| 3876 |
#~ msgid "" |
| 3877 |
#~ "WordPress's default large image handler for images larger than 2560px " |
| 3878 |
#~ "will be disabled for WP VR. So can create virtual tours with extremely " |
| 3879 |
#~ "high-quality images. Enabling it will also show high res image on mobile " |
| 3880 |
#~ "devices. Many devices may not support that resolution." |
| 3881 |
#~ msgstr "" |
| 3882 |
#~ "Domyślna obsługa obrazów WordPress dla dużych obrazów o większych niż " |
| 3883 |
#~ "2560 pikseli zostanie wył� |
| 3884 |
czona dla WP VR. Dzięki temu można tworzyć " |
| 3885 |
#~ "wirtualne wycieczki z niezwykle wysokiej jakości obrazami. Wł� |
| 3886 |
czenie go " |
| 3887 |
#~ "również wyświetli obraz w wysokiej rozdzielczości na urz� |
| 3888 |
dzeniach " |
| 3889 |
#~ "mobilnych. Wiele urz� |
| 3890 |
dzeń może nie obsługiwać tej rozdzielczości." |
| 3891 |
|
| 3892 |
#~ msgid "" |
| 3893 |
#~ "WP VR assets will be loaded on your allowed pages only. If you turn this " |
| 3894 |
#~ "on, you have to list the URL's of the pages with virtual tours on the " |
| 3895 |
#~ "'List of allowed pages to load WP VR scripts' option" |
| 3896 |
#~ msgstr "" |
| 3897 |
#~ "Zasoby WP VR będ� |
| 3898 |
ładowane tylko na dozwolonych stronach. Jeśli to " |
| 3899 |
#~ "wł� |
| 3900 |
czysz, musisz wyświetlić adresy URL stron z wirtualnymi wycieczkami na " |
| 3901 |
#~ "opcji „Lista dozwolonych stron do załadowania skryptów WP VR”" |
| 3902 |
|
| 3903 |
#~ msgid "WP VR will not load Font Awesome library." |
| 3904 |
#~ msgstr "WP VR nie załaduje czcionki niesamowitej biblioteki." |
| 3905 |
|
| 3906 |
#~ msgid "WP VR will resize each scenes for mobile devices." |
| 3907 |
#~ msgstr "WP VR zmieni rozmiar każdej sceny na urz� |
| 3908 |
dzenia mobilne." |
| 3909 |
|
| 3910 |
#~ msgid "WPFunnels" |
| 3911 |
#~ msgstr "WPFunnele" |
| 3912 |
|
| 3913 |
#~ msgid "WPVR Feature Comparison" |
| 3914 |
#~ msgstr "Porównanie funkcji WPVR" |
| 3915 |
|
| 3916 |
#~ msgid "Write your custom css" |
| 3917 |
#~ msgstr "Napisz swój niestandardowy CSS" |
| 3918 |
|
| 3919 |
#~ msgid "" |
| 3920 |
#~ "You can disable on hover content for mobile devices. As most of the " |
| 3921 |
#~ "devices are touch based." |
| 3922 |
#~ msgstr "" |
| 3923 |
#~ "Możesz wył� |
| 3924 |
czyć zawartość najechania na urz� |
| 3925 |
dzeniach mobilnych. Ponieważ " |
| 3926 |
#~ "większość urz� |
| 3927 |
dzeń jest opartych na dotyku." |
| 3928 |
|
| 3929 |
#~ msgid "" |
| 3930 |
#~ "You can use any image size but maximum image upload size recommended to " |
| 3931 |
#~ "support all device is 4096x2000 px for perfect responsive view. To check " |
| 3932 |
#~ "360 view, click on preview button and check tour preview metabox." |
| 3933 |
#~ msgstr "" |
| 3934 |
#~ "Możesz użyć dowolnego rozmiaru obrazu, ale maksymalny rozmiar przesyłania " |
| 3935 |
#~ "obrazu zalecany do obsługi wszystkich urz� |
| 3936 |
dzeń to 4096x2000 pikseli, aby " |
| 3937 |
#~ "uzyskać doskonały responsywny widok. Aby sprawdzić widok 360, kliknij " |
| 3938 |
#~ "przycisk Podgl� |
| 3939 |
d i sprawdź Metabox podgl� |
| 3940 |
du wycieczki." |
| 3941 |
|
| 3942 |
#~ msgid "Your Image In Tour Mode" |
| 3943 |
#~ msgstr "Twój obraz w trybie wycieczki" |
| 3944 |
|
| 3945 |
#~ msgid "" |
| 3946 |
#~ "Your rating and feedback matters to us. If you are happy with WP VR - 360 " |
| 3947 |
#~ "Panorama and virtual tour creator for WordPress give us a rating." |
| 3948 |
#~ msgstr "" |
| 3949 |
#~ "Twoja ocena i opinie s� |
| 3950 |
dla nas ważne. Jeśli jesteś zadowolony z WP VR - " |
| 3951 |
#~ "360 Panorama i Virtual Tour Creator dla WordPress, daj nam ocenę." |
| 3952 |
|
| 3953 |
#~ msgid "Your Viewers - And Make Them Take" |
| 3954 |
#~ msgstr "Twoi widzowie - i spraw, aby zabrali" |
| 3955 |
|
| 3956 |
#~ msgid "" |
| 3957 |
#~ "Zoom interval is 50 to 120 degree. You can put any value between 50 to " |
| 3958 |
#~ "120. As an example, if you set 100, the scene will display with zoom in " |
| 3959 |
#~ "100 degree on each load." |
| 3960 |
#~ msgstr "" |
| 3961 |
#~ "Odstęp powiększenia wynosi od 50 do 120 stopni. Możesz umieścić dowoln� |
| 3962 |
" |
| 3963 |
#~ "wartość od 50 do 120. Na przykład, jeśli ustawisz 100, scena będzie " |
| 3964 |
#~ "wyświetlana z powiększeniem w 100 stopni przy każdym obci� |
| 3965 |
żeniu." |
| 3966 |
|
